Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1703
Length(NT) : 800
Best Gene Model Blast : Link to GSTUMT00000435001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An04g02550
Accession: ref|XP_001401623.1| Score: 804 E_value: 5e-84
KEGG Definition: hypothetical protein
Accession: ang:An04g02550 Score: 804 E_value: 2e-84
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0465 Score: 743 E_value: 1e-79
PFAM Definition: GTP_EFTU, Elongation factor Tu GTP binding domain. This domain contains a P-loop motif, also found in several other families such as pfam00071, pfam00025 and pfam00063. Elongation factor Tu consists of three structural domains, this plus two C-terminal beta barrel domains..
Pfam Number: pfam00009 Score: 475 E_value: 2e-48
Swissprot: P25039|EFG1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003746 = Molecular function: translation elongation factor activity
GO:0006414 = Biological process: translational elongation

Sequence:
>Contig1703
AATCATGAGGGCTGCAGGAGTAAAATACAAATTCCGAACATTAAGGCTCT
CTCCCACTAGCACCACTACAGGTACCAGAGCACTGCGAATACCAACCACC
ACTGCCAGCAAGCCACCAAAATGTTTAGTTCCGTATTCCCCATCATCATG
CCCGTTCCTGCGAGTGGGCCACCCATTGGCTCTGAGCAAAGCAAGCAGCA
TTAGGGGTCTTGCAGCTGTAGCGGTTGCTCCAGCTGTTCCGGAGGAGCCA
GATATCATCCCGCAGGAGGAAATTCTCGCAAAGATGGATCCCAAAGAAAT
GGCTCGATTGGCGAGGGTCCGGAATATCGGGATTGCTGCGCATATCGATT
CTGGAAAAACTACATGTACGGAACGAGTCCTCTTCTACACTGGTAGGATC
AAGTCCATCCACGAAGTCCGCGGCAAAGACGCCGTCGGCGCAAAGATGGA
CTCGATGGACTTGGAGCGAGAAAAGGGCATTACCATCCAGTCTGCTGCTA
CCTTCTGCGATTGGGTAAAGAAGGAGAATGGCGTTGACGAGAAATACCAT
ATCAACTTGATTGATACTCCTGGGCATATTGATTTTACGATTGAGGTCGA
GAGAGCTCTGAGAGTTCTTGATGGTGCGGTTATGATTCTCTGTGCTGTTT
CCGGGGTGCAGTCTCAGACTATTACTGTTGATCGTCAGATGAAGAGGTAT
AATGTACCCAGGATATCATTCGTTAACAAGATGGACCGTATGGGGGCGAA
TCCTTGGAAGGCTATTGAGCAGATAAATAGTAAGCTGAAGATTCCTGCTG

Sequences in the Contig:

SY0AAA40YP15FM1 SY0AAA42YJ16FM1 SY0AAA5YA18FM1
SY0AAC21YI17FM1 SY0AAC34YK06FM1