Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1702
Length(NT) : 724
Best Gene Model Blast : Link to GSTUMT00002491001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: Ankyrin
Accession: ref|YP_920685.1| Score: 149 E_value: 4e-08
KEGG Definition: ankyrin
Accession: tpe:Tpen_1284 Score: 149 E_value: 2e-08
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 197 E_value: 3e-16
PFAM Definition: No Hit Found
Swissprot: Q01484|ANK2_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1702
TTGGGATACTTCAAACTCGACCTCCGACAATGCAATTACTTAAACTCCCG
AATGAACTTCTGATCCTAATAGCCTCAAACCTAGGTTTAAGTGACCTAAA
CAGCCTCCTCCGCTGTAACCGCGCCCTCTCAATCCTGCTAACCCCCCTCC
TCCACAAGCTAGCATTGCTAGACAAAGACGGCCTAGCACCTCTCTACTGG
GCAGCTCACGAGGGCCATGAGCATCTTGCCCGCCTCCTCCTGGATATGGG
CGCGGACATCAACGTGCGCAGCGGGCCAAACAAAAAGTCCGAAAACAAGC
TAACTCCGCTGCAAGCTGCCATCTGCTCGAAGAAGTCCTCGCCAACAATG
ATAAAGCTGCTAGTGGAGCGTGGCGCCTGCCTGAAAGCAAAGAACTCCTT
CGGAAACACCCCGCTGCACGACCTAGTTAGCAGTGACCCACCGACCCCTT
GCGCTTCGCTCCTACCGCTGATCTCTCTCCTCCTCTCTCACGGCGCTTCG
CTGTCCGCGCAAAACATATTCGGCGAAACGCCCCTACACCGTGTATATGA
CGGTCCGCACTGCAGAAAGGTGATCCCGCTGCTACTCGACAAGGCCGACC
CTGCCATCCTTGGGGTGCAGAACAAGGACGGTGTGACGATACTGCACAAG
GCAGTGCAGTTCAATGATATCGCGAGCTTGCGGCGGGTGCTGAAGATGAA
GAGGGATATTATTAACGTCCCCGA

Sequences in the Contig:

SY0AAA5YA08FM1 SY0AAC12YP23FM1 SY0AAC16YH23FM1
SY0AAC16YL16FM1 SY0AAD59YE17FM1