Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1701
Length(NT) : 369
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1701
TACTTACTCCATAATGCCCACTCTATAACTCGACCACATCCACCTCTACT
TCCACGCTACCGATACCTAGCTACCTAGCTACTGTACTACCGGTAGTGCA
TACTCTTCTATCCCCCAACCTCTGCAGCAGGCACTGAATCGGTCGAGCAA
GTTCAAGTCCTTACACTTGCGCACCCCACACGCACCCATATCTTCCCTGG
AGGAAGAAAGTGGGCAGATACTGGTACGGCACAGACAGGAGGAGCGATCA
TACCCCCCTCAGGCTCTACTGTACTACTCGAGTACGAGTACCTTACCCCT
CCCCCTCCCCCTCCCAAACGTTCACTTTTATTTGTTTTTTTACTTCTTCG
AAACCAAGAATTCCCCCCC

Sequences in the Contig:

SY0AAA13YJ20FM1 SY0AAA59YP13FM1