Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1700
Length(NT) : 1058
Best Gene Model Blast : Link to GSTUMT00007437001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein ACLA_027910
Accession: ref|XP_001269492.1| Score: 166 E_value: 7e-10
KEGG Definition: hypothetical protein
Accession: dha:DEHA0A11583g Score: 160 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1700
TTGGCCTTCCCGCCTCTCGTGAAACTAGCTCTTGGCGACACCACACGTCC
AACACGCCCTTACCAGGAAACCTTCACGTCCGAGCCCTACAGCAGCTGTA
CCCCGGCTCAAGCCAACTCGCAAACACAAGCCTCAGTCATGTACTCCCGC
CGTCACCCGAACAAACGTGGCAAACCTCCCGAAGATACAATCATCACACA
GTACAAGAACTTCATCAGGAACTCTCAACGAGACGAAAACGGGAACCGAT
TCGTAGAGGCTATCGTCACAATGCCTCCCAGTAACGATTGGACTCGCATC
AACCGTCGGAGGAAAACCCTCCAGCCCCGCCCTCCAGAGATTGTTGACGG
GGACAGCCGCACAACTGGGGCCCCGTCCCTGCATGTTCTTGCTCGCCGGA
CATTGAATAAGCATATCGAGGAGTTCACAGCCGAAATACTAAGAGGTATC
CCCTGGGTTATCATAAAGCCTATCTGGGAGGACGCTTTGAATACCTCAAG
AGATAGCTTTCTTGTGTGGTCTAGATTCGCTTCTGTCTATGGGGATGAAC
CCGACTTCGCGTGTCATTCCAGGGCCCAGAGCAGTGGACCAGTTATGGAA
CGTCTACGGATTGAAAAACTCGCATATACAGTTTCCCTTGGGTCCCTAAT
AGGCCCCATATCCAATAATCAAGGGATGTGGATTGTATACCTAAACCTTC
TGTATAACAAAGGTTACACCAGGGAGGAGCTTTTATGCATACCAGAAATC
CCCAATCTTGTGGTTCTAAATTTCCCTTTCGCCAGTAACGGACAGGTTAG
CACCCTTGACGATGGTGTAATTAGGTCCTGGTCTCGCTCCTCCTCCAGGG
ACGGGAAGCTATCCAGGTTGAAGGTGCTAATCCTTAGGAACCACGCGGGG
ATTTCCAACGAGTCCCCTAAGTACCTCAGCTGGATCAAATCCCTGGAAAT
AGTCGAGCTTACTGACACCAATATCACCTCCGATGCTCCATACTGGGGTA
TGCATTGGGAACACGATAAATCCCGGTTGTGGGAAGATCTGGCCACGACC
CGCGGGGT

Sequences in the Contig:

SY0AAA24YF23FM1 SY0AAA24YF23FM2 SY0AAA59YJ24FM1
SY0AAC20YK12FM1 SY0AAC54YD09FM1 SY0AAC61YB06FM1
SY0AAD46YO20FM1