Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig170
Length(NT) : 765
Best Gene Model Blast : Link to GSTUMT00006227001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_11334
Accession: ref|XP_001550561.1| Score: 697 E_value: 1e-71
KEGG Definition: hypothetical protein
Accession: ang:An01g09480 Score: 683 E_value: 2e-70
KOG Definition: No Hit Found
PFAM Definition: CDP-OH_P_transf, CDP-alcohol phosphatidyltransferase. All of these members have the ability to catalyse the displacement of CMP from a CDP-alcohol by a second alcohol with formation of a phosphodiester bond and concomitant breaking of a phosphoride anhydride bond..
Pfam Number: pfam01066 Score: 220 E_value: 6e-19
Swissprot: O94584|YQ7C_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0003882 = Molecular function: CDP-diacylglycerol-serine O-phosphatidyltransferase activity
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0010512 = Biological process: negative regulation of phosphatidylinositol biosynthetic process
GO:0006646 = Biological process: phosphatidylethanolamine biosynthetic process
GO:0006659 = Biological process: phosphatidylserine biosynthetic process
GO:0032956 = Biological process: regulation of actin cytoskeleton organization and biogenesis
GO:0032465 = Biological process: regulation of cytokinesis

Sequence:
>Contig170
TTGGCTAGTCCCCCCCCTCTCTATCTTCCCTATCAAACTCAGACCTTATC
TTGAATCTTTTTTTCCTACCGGAAGATCTCCTGGTTTTTGTATACCCACT
TGAGATACGGAGTTTGAACTTTTTATCTCCCATTAGCACACTCTAAAAAA
GGGACACGAACAATGTCACGAAGAAACGGAACGGCCGCCGCCAATGAGCA
GAAGCCATTGGTTTCACCAGAGGATCAAGCAAAGGTATCTGCGCTCGCTG
ACGATGACCGACATTTCTCCATGATCAGGGCGCTCCATATGGCCGATCTC
ATCACTGAGCTCAACGGTTTCTGCGGAGCGATGAGTATCTTTTCATCACT
GCGATACTGTCTTGGTAGCCCTGACGACCTCACCCAACTTTGGCTCGCCA
TGACTTTCATGCCATTCGGACTCTTCTTTGACTTTATGGATGGGAAGGTG
GCTCGCTGGAGGAAGAAGAGCTCCTTGATGGGACAGGAGCTTGATTCCCT
CGCAGATTTGATCTCCTTTGGCATGGCCCCGGCTTCTTGTGCCTTCGCTC
TCGGCTTTCGTACGTTCCTGGATACCATCATCCTCACGCTTTTCGTTCTC
TGCGGCCTCTCGCGTCTCGCGCGCTTCAACGTGACGGTTCAATCTCTCCC
CAAAGACGCTACGGGAAAGTCCAAGTACTTTGAGGGCACACCGATCCCTA
CTACCCTCTCCATCGTCATGGCTATGGCATACTGGGCGCACAAGGGATGG
TACTTGGGCAACTTG

Sequences in the Contig:

SY0AAA16YC06FM1 SY0AAC47YN02FM1 SY0AAC52YI24FM1