Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig17
Length(NT) : 1395
Best Gene Model Blast : Link to GSTUMT00008004001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: actin
Accession: ref|XP_001536648.1| Score: 1170 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU07171.1 Score: 1133 E_value: 0.0
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0677 Score: 1282 E_value: 1e-141
PFAM Definition: Actin, Actin..
Pfam Number: pfam00022 Score: 785 E_value: 4e-84
Swissprot: Q9UUJ1|ARP2_SCHPO
Gene Ontology:
GO:0005885 = Cellular component: Arp2/3 protein complex
GO:0007015 = Biological process: actin filament organization
GO:0030100 = Biological process: regulation of endocytosis

Sequence:
>Contig17
TTGGGGGAGCTCGACCACCGCATTCTCTCTCCCCGCTTCAACAACCACAA
TTATACCTTTGGAACCCACTCCGTAACCTAGAAATTTCCCTATTCCAACT
TCTCTCGTTTAATTCCAAGATGAACGAAGCTCCTATTGTTCTCGATGGGG
GAACTGGTTTCCTTAAGGTCGGATACGCTGGCCAGAACTTTCCGGAACAC
CAGTACCCGTCTATCGTTGGGCGTCCGATATTGAGAGCGGAGGAGCGTGC
TGGCGATATGATTGTGAAAGATATTATGGTCGGGGACGATGCTGCCGCCG
TTCGGACGATGCTACAGATTACATATCCGATGGACAACGGTATTATCAAA
AGATGGGAAGACATGCAGCACGTGTGGGACTACACATTTTCAGAAAAGCT
ACAAGTCGATACCACCGGTCGTAAGATCTTACTCACGGAGCCTCCCATGA
ACCCGTTGAGCAACAGAGAGAAGATGTGCGAAGTTATGTTCGAAAGGTAT
AACTTCGGGGGTGTTTATGTCGCTATCCAGGCGGTGCTCGCTCTCTATGC
TCAAGGTTTAAGTTCCGGTGTCGTCGTCGATTCCGGAGACGGTGTAACCC
ACATCGTCCCTGTATACGAGAGTGTGGTCCTTAACCACCTTACCCGCCGT
CTCAATGTTGCTGGCCGTGATGTTACCCGCCAGCTCATCAACCTTCTCCT
CCGCCGGGGGTATGCTTTTAACCGTACTGCCGATTTCGAGACTGTCCGCC
AGATTAAAGAGAAGCTATGCTATGTCAGCTATGACCTAGAGCTCGACCAC
AAGCTCGCCGAGGAGACTACTGTTTTGGTGGAGAGCTACACCCTCCCAGA
CGGCCGTGTAATCCGTGTCGGTAGTGAGCGATTTGAGGCGCCGGAGTGCC
TCTTCCAGCCCCACCTCGTGGGACATTGAGCAGCCAGGAATCGCAGAGTT
CCTGTTCAACACTATCCAGGCTGCCGACGTAGATGTCAGAACCTCCCTAT
ACAAGGCTATCGTACTTTCCGGCGGTTCAAGCATGTATCCCGGCCTCCCT
AGCAGATTGGAGAAGGAATTGAAGCAACTATGGCTTACCAAGGTGCTACA
CGGTGATCCGACACGACTAAGCAAATTCAAAGTCCGGATCGAAGACCCTC
CACGAAGGCGTCACATGGTCTTCCTTGGCGGCGCCGTTCTCGCGAACATT
ATGGCGGACAAGGAGAATATGTGGATCACAAAGGCGGAATGGGAGGAACA
GGGTCCTCGTATCATTGAGAAGTTAGGTCCTCGGTAAAAATATCCGTGAG
AGGAAGAGGAGCAAAAACAGTACCTTGTAGATGGTGGTTTGTGGTTTCCT
TTTTTTTTCTTTCCTTCTCTCTTCGTGCGCTCTCCTGATACCGAA

Sequences in the Contig:

SY0AAA10YI11FM1 SY0AAA13YF04FM1 SY0AAA31YP12FM1
SY0AAB22YK10FM1 SY0AAB36YE02FM1 SY0AAC14YO20FM1
SY0AAD57YK04FM1 SY0AAD60YG07FM1 SY0AAD60YM22FM1