Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1699
Length(NT) : 1770
Best Gene Model Blast : Link to GSTUMT00009952001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: Lcc2
Accession: gb|ABS19939.1| Score: 839 E_value: 4e-96
KEGG Definition: hypothetical protein
Accession: fgr:FG11427.1 Score: 841 E_value: 2e-95
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1263 Score: 547 E_value: 2e-56
PFAM Definition: Cu-oxidase_3, Multicopper oxidase. This entry contains many divergent copper oxidase-like domains that are not recognised by the pfam00394 model..
Pfam Number: pfam07732 Score: 414 E_value: 6e-41
Swissprot: Q96WM9|LAC2_BOTFU
Gene Ontology:
GO:0008471 = Molecular function: laccase activity

Sequence:
>Contig1699
TTGGGGATGGGGGGAGGGGAGAAGAAAAATAAAAACATTTTTTGTATCCT
TTAAAAAGCCTCTCTTTAGACCGGCTAGAATAGGGATAAACTCCAAAATT
CTGAATTACCCTTCGGAAATGGAACTACTCAAATTTCTACTTCATATCCT
TCAGTCCTTTGGCCTTCTGGGGCGTGGGGGTAATGATCTCAACCAGGAGA
TACTGGATGCTGGCGGCCTCCTTCCTGACCTGTCTGGGGTTGCGGGAGCA
AACGCACTGATTCCTTCCACCGGCTTCAAGTGTCCAAATTATAGCCCTCG
GGGAATCAAGGAGGACCTAATATCTTGCAATACTCCTGACAATCGGTCGT
GCTGGTTTAAGCCAAATAAGTGGTGGGCCCCAAGGGGTTACGATATCAAT
ACGGATTATGAGTTTAGTTGGCCGGATGGGACGCATAGAGAGTATTGGCT
TGAGGTCACTGATGGCAAGACTGCACCTGACGGATATGTTAAAACCAAGG
CGAAGCTAGTGAATGGGACATACCCAGGACCACTCATCGAGGCGTGTTGG
GGCGATCAACTTACTATCCATGTTACCAATAAGATGAGGGATAACGGCAC
CACTATCCATTGGCATGGCTTCCGGCAGTGGAACACCAGTGAAGCTGATG
GTGTGAATGGAATCACTCAATGCCCAATTGCCCCGGAACACACCTACACA
TACAAATTCCGTGCAACGGAGTATGGGCACACATGGTATCATAGCCATTA
CTCCCTGCAATATCCCGATGGAGTTCTCGGACCAATGATCATTCACGGTC
CTCAAAGCGCAAACTACGATGTCGATGTCGGCACTGTCCTCGTCAGCGAC
TGGTCGCATGAGACAGCGTTTATTGACTTCTTCGGAGAGCTCACAGGCAA
CCCCCCGCCAATGCAAAGCAATCTGCTTCAAGGCAGGGGCCGATTCCCTT
GTTTCCAAGGAGACCCCAGATGTGTTGGGCCTCCTGGCAATTACTACGAG
CTTAATTTTGAAAAAGGGAAGAAGTACCTATTGAGATTGATCAATACATC
CACTGCGTCGCAATTCAAGTTCTCAATTGATAACCATATCCTCACGGTTG
TTTCTGCGGACTTTGTGCCTATACACCCTTATCAGACAAAGTATTTGAAC
ATCGGTATCGGCCAAAGATACAGCGTAATTGTTGAAGCGAACCCCTCTGG
CCCAGATGTATCTGTAAACAGGGACTACTGGATTCGAACAATCCCTGCAG
CGGGTTGTAATAACATCCAATTCCCCGTCAAGCAAACTGGCATAATTAGA
TACTTCTCTAACTCCACATACACCCTCCCTGTATCCAGCTTCTGGGTAAC
ACAAAAAGGTCAAACGACGGAGCCTGATGACTGCGACGACGAGGACATGA
AAAATCTCGTACCCGTCGTGCCAAAGAGTTTGGTCCCCGGGGATTATGCA
AATAACTATTCCTCCGATACCTATGAAGTTGGCCTGACAGAGCCGACAAT
CGAGAATCCCATGCCCCATGGGTAACTATAGCCGATGGGATATTGCCACG
CTTCCTATGTGGCTCGAATGGGGAAACCCAACCATATTGAATCTTGATAA
GAATGTTAGCAATATGAGTCAAGAATTGTCGATTGTCCCCGAGGATTATC
AGAATAGGTGGGTTGTTCTAGTGGTTGTCGGCAATTTGACGCTCCCGTCC
GGACATAGCGCTGGAAAGCAGTCTATCCCTACCAGGCACCCTATCCACGT
CAGTCCTATCCCCAAACTCT

Sequences in the Contig:

SY0AAA11YA24FM1 SY0AAA33YH12FM1 SY0AAA54YK20FM1
SY0AAA55YB19FM1 SY0AAA59YF15FM1 SY0AAB12YN01FM1
SY0AAB35YK17FM1 SY0AAB4YB07FM1 SY0AAB61YK20FM1