Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1698
Length(NT) : 779
Best Gene Model Blast : Link to GSTUMT00003042001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_01541
Accession: ref|XP_001247770.1| Score: 289 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU05960.1 Score: 256 E_value: 8e-21
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2647 Score: 262 E_value: 9e-24
PFAM Definition: Mannosyl_trans2, Mannosyltransferase (PIG-V)). This is a family of eukaryotic ER membrane proteins that are involved in the synthesis of glycosylphosphatidylinositol (GPI), a glycolipid that anchors many proteins to the eukaryotic cell surface. Proteins in this family are involved in transferring the second mannose in the biosynthetic pathway of GPI..
Pfam Number: pfam04188 Score: 248 E_value: 4e-22
Swissprot: Q2GSI6|GPI18_CHAGB
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig1698
TTGGAGAGAAGTTCTACAGAATTGCCCACAACCCCCGGTACCGGAGGACT
GGTACAATGCTGGTATCATAATTATGATATCACAGACTTGCATGGTCCCT
GCCAAGCCGACCTTCCCCAACCAACCCTGATTGTCTTGCGACCACCACGC
CTATGGTACTCGTACATCTCCACTCCTACTGCCCTCCAAGCCATCATGCC
ACCCAGCATAATTCCAAAAGCCTTCTTATCCTGGAAGCTCCTCCTCCTCG
CCATAACCCTCCTAACACCGGCACCCTATGACACTTCCACATCCCTTGTC
CTCCCAGCGCCAAAAACGCTCCTGCAGACGCTGCTACAGAAACTAACCCG
CTGGGACGCAATTTACTTCGTCAAAGCGGCCCAACGCGACTACGTCAACG
AGCAAGAATGGGTTTTTGGGTATGGCTTTGTTAAAGCGATTTGCGGAGTT
CATTGGGCACTCTCCCCGGCACTCAAGTATATGGACCTACCACAACCCTA
CGATTACGCCCTCTCCGCTGTCCTCCTGGCGAACCTCGCGCACGCGCTAT
CAACAGCAGTACTCTACGCCATCACGCGAGAAGTCTTCCCTTTGAATGGG
AAATTACCCATTGTAGCGGCCCACTTGCACGTCATTTCCCCCGCTGGACT
CTTCCTTTCGGCGCCGTACAGCGAGTCGTTGTTTGCCCTGCTGAGCTTCT
CGGGATTGTACTGCTATGTACGCGGATACATAATAGTTTCTGGTGCGTGG
ATGTTTTTGGCAAGCATGGTGCGGAGTAA

Sequences in the Contig:

SY0AAA59YC14FM1 SY0AAB7YL19FM1