Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1697
Length(NT) : 721
Best Gene Model Blast : Link to GSTUMT00012210001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: chitin biosynthesis protein (Chs5)
Accession: ref|XP_747827.1| Score: 653 E_value: 1e-66
KEGG Definition: chitin biosynthesis protein (Chs5), putative
Accession: afm:AFUA_6G02510 Score: 653 E_value: 6e-67
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q92357|CFR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005794 = Cellular component: Golgi apparatus
GO:0032219 = Biological process: cell wall catabolic process during cytogamy
GO:0006031 = Biological process: chitin biosynthetic process
GO:0009250 = Biological process: glucan biosynthetic process

Sequence:
>Contig1697
TTGGCAACCATCTGTACCTCCACAACTCCCCTCCTTCAATTCCGTGTTTC
CATCATCCAGAGCTCAATCTTCCCTGCCCCCACAATGCTGGTTTCACTTA
CCGTTGGAAAGGTCGATGCCGGCCTAGCCATCCTTCTTACCGAGGAGAAA
CGACTGGTAGGTTTGACCGCATTTACTAGCGAGCGGGTAGCTCGATTGGC
GGAGGGTATTCAGAAAACTGACAAAACCAAGATCGAATTTCCCTCCGTTC
TTCTACCTCCCGGAATCGTGTCCGGCTCGATAGTCGACATTCAGATCTCA
CAGAACACAGAAGCCGAGGATGCAGCAAGAAAGGCCTTCAATGCTCTGCA
GGAGGAGATCTACAACCTCTATGGAATCCACTCTCCTTCAAAACCCGTCC
TGCGTGTGAGGAATGCCACGCAGACATCTGTTGTGCTCGAGTGGGATCCG
GTCCAGCTAGCTACAGCCACTCTCAGAAGTTTGACTCTCTACCGCAATAA
TTCCAAGGCCGGAGCTATCCCGAACCCAACGACTCACACTTCTACGAAGA
TCAGCGGACTGGCGCTGGATACCGAATATTCTTTCCATCTCATCTTACGA
ACTAGCGCAGGTACCTACTCTAGCGAGAAGCTGACTGTAAGAACCCACAA
GATGACTGACCTATCGGGTATCACGGTATGCCCTGGCGTCATGCCAGGAG
AGACCAGGGAGGAACTCGAAG

Sequences in the Contig:

SY0AAA20YC22FM1 SY0AAA58YP21FM1 SY0AAB56YI11FM1
SY0AAD52YN10FM1