Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1696
Length(NT) : 1073
Best Gene Model Blast : Link to GSTUMT00000091001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1696
TTGGGTCTCCTACACCTTCACCGTTGCAAAGGACTATGGAAAATTTCAAT
AATCAGTCCACCATGGCCGCCCTCTACGACAGCCGAACTCGCGAGAGCGA
AGTCTCTCCCTGGCACCGCCCTGTGGCGGCGCCGCCTCCCCAGTCCGCTG
TTTCCAACTCCACCTCGAACCATGTGAGTTTTTCTCATGAGTCTTTGAGT
ATCCCTAGACACATTTCATCACCTTCTGAGGTTCCAAACGTCGAGAGTGT
GGGAGTGACGAGGCCTCCCCCAGGCTTTGAGGACAAAGCCGCCAAATATT
ACAACATCAAGATTACGAACTTGCCTCGTGCCGTTTCTGAGCGTGAACTC
AATGCCATGCTCTTGTTTGCTGGTGACCTTGCCGGCATACGTGTGAAGCC
ACCTTCCCCTGGGGGTGTTGAAGGTGACTACAACACCACTGCGGTCGCCC
AATTCGGCTCCGAAAAATCTGCGAAGGAGGCCCAGGAACGACTGGATGGA
AAACCCTTTTCCCCTGAAGATCGCAAAATGTCGGTTCAATTATTAGGGAG
CTCGCATGAATCGTTAATTCAATCCGCCTCTAACTCGCCGTCCAATTCGG
ATGTGCTGATACCCGGTACCGACTTTCCGCAGTACACTACGAACGGGACT
CGCAACCGAGGATCCCCACCAAATGGACAGCTCTATGGCGCTACAAATGG
TTCCAGCGGAATTGGTGGGGTCAACAGTGTCAATGGCACCAACGGGATCA
ACGGAGCTAGCACCTTGAATGGGATCGCTACGACAAACGGGATGGTTCCA
ACGGGCGAATCATCCTTCGACCCAAGGCCATTTGACCTTCGGGAATCTCC
TAGCTTCTTCAACCCGTTGGGTTTCCAGCAACCTCCCCAATCCGGACGCC
AGCAGCAGGCCCAGCAACCACAGAGGTTGTTCATGCCTGACGAGTATGAT
GGAGACGATAGCGGCATTTCGACAAGAGCTCGTGCCTTGACCAGTCCTGT
TGTAGCTGCTGGAGCGAGGGGCCTTGGGGGCTTGCCACAACTCATTACTG
CAAATAATACTGTTAATTGTTTT

Sequences in the Contig:

SY0AAA58YO18FM1 SY0AAB42YJ03FM1 SY0AAC9YN07FM1
SY0AAD61YK24FM1