Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1695
Length(NT) : 2210
Best Gene Model Blast : Link to GSTUMT00009341001 E-value : 0.0
Numbers of ESTs : 68

Blast Results:

Nr Definition: heat shock protein 60, mitochondrial precursor
Accession: ref|XP_001539356.1| Score: 2355 E_value: 0.0
KEGG Definition: antigenic mitochondrial protein HSP60, putative; K04077 chaperonin GroEL
Accession: afm:AFUA_2G09290 Score: 2334 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0356 Score: 1955 E_value: 0.0
PFAM Definition: Cpn60_TCP1, TCP-1/cpn60 chaperonin family. This family includes members from the HSP60 chaperone family and the TCP-1 (T-complex protein) family..
Pfam Number: pfam00118 Score: 1004 E_value: 1e-109
Swissprot: O60008|HSP60_PARBR

Sequence:
>Contig1695
TTGGCCCCCCAACTTCCATTCCTTCTCAATTAAGTTTGATTCGACTATCC
TTGGATATCTCATTACTTCCCAGAATTCAACATCCTCCTAGCTGCAATTG
AACATGCAGAGAGCACTTTCTTCCGCTGTCAGGGTCCGTCCCTCTTTCTC
AACCGCGAGACCCTTGGCTCTTGCTTCAAGTCTTATGTCAAGCCATCAGC
AATCCCGGGCATACTCTCACAAAGAATTGAAATTTGGTGTTGAAGGAAGG
CAATCGCTACTTGCTGGCGTGGACATGCTCGCAAAAGCTGTGGCTGTCAC
TCTGGGCCCTAAGGGAAGAAGTGTTCTGATTGAATCATCGTACGGAAGTC
CCAAGATTACAAAAGATGGTGTAACGGTAGCAAAGGCTATTACACTGAAA
GATAAATTTGAGAACTTGGGCGCTCGTTTGCTTCAGGATGTCGCGTCAAA
GACAAACGAGGTTGCTGGAGACGGTACTACTACCGCTACGGTTCTTGCTC
GTGCTATCTTCACTGAGACTGTCAAGAACGTTGCCGCTGGCTGCAATCCC
ATGGATCTTCGCCGCGGAACACAAGCGGCTGTTGAGGCCGTTGTCGACTA
TCTTCAGAAGAATAAGCGAAATATCACCACCTCGGAGGAGATCGCTCAAG
TCGCAACTATTTCCGCAAATGGTGACCAGCATATTGGAAACTTAATTGCT
CAGGCTATGGAACGGGTTGGAAAGGAGGGTGTTATTACTGTTAAGGAGGG
AAAAACCATTGAGGACGAACTGGAGGTTACGGAGGGAATGAAATTCGATA
GAGGATATGTTTCACCCTATTTCATTACCGACACCAAGACCCAGAAGGTT
GAGTACGAAAAGCCTCTAATCCTTCTAAGCGAAAAGAAGATCTCTGCTGT
TCAGGACATTATCCCCGCCCTAGAGGCTTCTACTACGATGCGTCGCCCTC
TTGTTATCATTGCCGAAGATATCGATGGCGAGGCTCTTGCTGTGTGTGTT
CTCAACAAACTCCGTGGACAGCTCCAGGTCGTTGCTGTCAAGGCCCCCGG
TTTCGGCGACAACCGCAAGTCCATCCTTGGGGATATCGGCGTTCTGACCA
ATGCAACCGTTTTCACTGATGAGTTAGATGTCAAGCTCGAGAAGCTTACT
TCTGACATGCTTGGTAGCACTGGCTCGATCACCATTACTAAGGAAGATAC
TATCATTCTCAATGGTGAAGGTTCCAAGGATATTATTGCACAGCGTTGTG
AACAAATCCGTGGTGTTATGAACGACTCCACTACTTCTGAGTACGAGAAG
GAGAAGCTCCAAGAGCGCCTTGCAAAGCTTTCAGGTGGTGTCGCTGTTAT
CAAGGTTGGTGGAGCTTCGGAAGTTGAGGTTGGAGAGAAGAAAGACCGAT
TTGTCGACGCTCTCAATGCTACCCGTGCTGCCGTCGAGGAAGGGATCCTT
CCTGGAGGTGGTACTGCTCTACTAAAGGCATCCACAAACGCACTAGGTAA
TGTCAAGGTTAACAACTTTGATCAGCAACTCGGTCTCTCGATTGTCAAGT
CGGCAATCACTCGCCCCGCACGCACAATTGTTGAGAACGCAGGAGGTGAG
GGGTCTGTGGTTGTTGGGAAACTTACTGGAGAGTATGGTGGAGACTTCAA
TATGGGTTACGATGCCTCCGGGGGCGAATATGTCAACATGATCGAGGCTG
GTATTGTGGACCCACTGAAAGTTGTCAGAACTGCTCTCGGTGATGCTTCC
GGTGTTGCCAGTCTTCTTGGTACTACCGAATGCACAATCGTCGATGCTCC
GGAGGAGAAGGGACCCCCAGGTGGAGGTATGGGAGGCGGTATGGGAGGAA
TGGGAGGAATGGGTGGGATGGGTGGTTTCTAGGTGTGAAGAGGTATTGGG
GATGCTGAGTGTGGCCTTGAAAAATAATGCGTAGTTATGTATCATTGAGC
GAATGCTTTTACCCCCTCCTTACCTTCCTTCATATATGGCTCTAGGTCTT
TTCCGTAGTTATGCTCTCTCTCCCCACTCACTTTTATTTCTTCACTCTGT
TAACCAAAAAGCATCTACCTTTGTCTCTTTTCTTCCTTTTCTTCCTTTTA
TCATATGTATATCATAACTCCCGGGGCGCTGCACAAGTGCGTTGTATATA
CGGACAGGCATATGGAATGAGACCGAGCACCTAGAGCGGTGACTGCCATT
ACTCTGATTT

Sequences in the Contig:

SY0AAA10YF12FM1 SY0AAA13YB05FM1 SY0AAA13YF14FM1
SY0AAA15YE14FM1 SY0AAA19YB23FM1 SY0AAA19YP18FM1
SY0AAA22YI17FM1 SY0AAA22YN22FM1 SY0AAA28YF05FM1
SY0AAA30YE09FM1 SY0AAA31YG13FM1 SY0AAA32YM17FM1
SY0AAA32YM17RM1 SY0AAA38YM13FM1 SY0AAA39YP20FM1
SY0AAA3YK16FM1 SY0AAA41YP15FM1 SY0AAA46YH04FM1
SY0AAA48YF14FM1 SY0AAA48YI03FM1 SY0AAA49YA19FM1
SY0AAA49YC06FM1 SY0AAA4YK16FM1 SY0AAA53YE16FM1
SY0AAA56YG04FM1 SY0AAA57YF13FM1 SY0AAA58YO10FM1
SY0AAA60YE16FM1 SY0AAA6YK24FM1 SY0AAA7YE08FM1
SY0AAA9YN07FM1 SY0AAB10YK14FM1 SY0AAB22YB11FM1
SY0AAB23YI10FM1 SY0AAB24YC22FM1 SY0AAB27YL02FM1
SY0AAB27YO02FM1 SY0AAB28YJ16FM1 SY0AAB31YI10FM1
SY0AAB34YA16FM1 SY0AAB35YE08FM1 SY0AAB36YI09FM1
SY0AAB39YG05FM1 SY0AAB40YE04FM1 SY0AAB45YC11FM1
SY0AAB45YO02FM1 SY0AAB47YO08FM1 SY0AAB49YF12FM1
SY0AAB49YN12FM1 SY0AAB52YO06FM1 SY0AAB53YM15FM1
SY0AAB56YL23FM1 SY0AAB58YN16FM1 SY0AAB7YI12FM1
SY0AAB7YJ12FM1 SY0AAC18YH17FM1 SY0AAC30YG14FM1
SY0AAC30YH13FM1 SY0AAC48YE03FM1 SY0AAC5YA08FM1
SY0AAC61YE07FM1 SY0AAC62YM05FM1 SY0AAD14YO18FM1
SY0AAD16YM12FM1 SY0AAD18YK23FM1 SY0AAD45YB08FM1
SY0AAD52YN13FM1 SY0AAD62YB16FM1