Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1694
Length(NT) : 1107
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1694
GCCGGCCATATTTCGTTTCTCGTTTCTGGCTTTTCACCCGTTCGAAGAGT
GGTTTGTGTGGAGTCGACCAGAGATGGACCTGCCCTAACTGTCGTCGGTA
TCGGTTTTCGGCAGTCAGGAGGGTGATGAGGGGGCTAGGGCTTCGGAACT
TCAGGTACCGATCCTCACACTTGTGAGAGAGCCGGCCAACTCAGCCACAG
AAACTTGCTCCCAAGTTGGTCTTGTGCCTGGTGTGAGCCACAATTTCGCG
CTTTTGCACGGATTCCTTTCGCACAGATTCATTTCGTCTGCCTTGTTTGG
GTTGGGGTTCAGCTGTTCCTTCCATTTTCCCAAGAACATCGCCCCTATTA
CACTAATGGCTTTTCTACCTTGTCTTACGCGCACACCCAATACACTCTTG
GGACGGCAACTGTTGAGGGAAAGGGGGGAGGAAATGGAGGAAATGGAGGG
GACCAAGATTGTATTTTCATTGAAAAGGATATGGTGGATCAGACAGCAAT
AACAGGAACCCGCGGAAACCGAAATGTTTGCGGGGGTTTTTTGCCTCAAC
CTTCCATCCTTTTTTGTTTTCTTTTCTTTTTCCCGTCTTATCCCAGTCGT
TCTCCAAGTTACACGTACAACTCCAGATTATGTGGGCAAGTGAATTGTCA
CTTCTCGCTCGACACTGGACGCCCGGCCGAGATCTAACCCCCTCTTTTGA
GAAACGGAATTACCACTTGTAGCGAATCCGGAACCTTGCTTTCTGGGGAG
GGAGGACGCGAGAGAAGGGGTGTAAGCAGGGTGAAGAGAGGCCGGGAAAA
TGGTGGGAAAGAAGGGAAGGGAAAATATTATGGGGTGTGAAGGAGGAGGA
GGTTGTATCTGTGCACTCGCTCATTTCATCTTTAGAACTAATTTTTTTGG
GCTATTTCCCAGTCTTCTGCGTTCTGTGTGTGTACCTGAGGTTTTTTTAT
CGTGTCATTTTGTGTTTCTCCAGACATACTCTATCCACGGAGACTAGGCC
ATTCTCCACTACTGAAATTACCCTTCCGTGGTCTGGTGGGTATCTACGAC
ATCTCCGACATTGCCCCAGCAGTTGGGAGACTGAAGTAATACTCGGTTTC
GAGGCTA

Sequences in the Contig:

SY0AAA45YE19FM1 SY0AAA58YO08FM1 SY0AAB31YD20FM1