Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1693
Length(NT) : 740
Best Gene Model Blast : Link to GSTUMT00007233001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_05838
Accession: ref|XP_001592916.1| Score: 663 E_value: 9e-68
KEGG Definition: leucine rich repeat proteins, some proteins contain F-box
Accession: aor:AO090120000268 Score: 592 E_value: 8e-60
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1947 Score: 255 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: Q8BH16|FBXL2_MOUSE

Sequence:
>Contig1693
TTGGCCGAATTCCATCCAATGTACGCGGAACAGCAACTCCAGCAGGCACA
AGCTGCGGCTGCCGCAGCGAATAACCCTTCAAGATACAATCCCGGCCAGC
AGGCCCCACCCCAACCACCACCAATGTATCCCGCCCCAGGTACCGTAATC
GGATGTCCAAACCTCAGCCGGCTGACATTGAGTTATTGCAAGCATGTCAC
TGACCGCACCATGTCCCACCTTGCGGCGCACGCAGCCCGTAGGTTGGAGC
ATGTGGATCTCACGCGATGTACCACTATCACAGACCAAGGATTCCAGAGC
TGGAGCATGACGCGCTTTGAGAGACTACGAAGTCTATGTCTAGCAGATTG
CACCTATCTCACCGACAGCGCAGTAGTATTCCTTACGAACGCGGCTAAGG
GTCTCCGAAGCCTTGATTTGTCTTTCTGCTGCGCCTTATCAGACACAGCA
ACGGAAGTCCTCTCACTTGGCTGCCCGCACCTATCCGTCCTAAAACTGTC
GTTCTGCGGATCCGCCGTGTCTGACTCATCACTCAGAGCAATAGGTCTGC
ATCTGCTTGAACTTCGCGAGCTTTCCGTCCGCGGATGCGTGCGCGTTACG
GGCGTGGGCGTGGAAGCGGTGGTGGAAGGCTGCCACAACCTCGAAGTCTT
TGACGTGAGCCAGTGCAAGAACCTCGCCAGGTGGATAGAGAGCGGTGGTG
TGGAAAAGTGCACGCAAACGTGGAAGCGGAATATCAGGTT

Sequences in the Contig:

SY0AAA58YN15FM1 SY0AAD30YG03FM1