Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1692
Length(NT) : 904
Best Gene Model Blast : Link to GSTUMT00006855001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1692
TTGGAACGAACCGACGAGAGCGAGGAGGAGAAGATGATCACGGCCCTAAC
CTGCAATGCTTGCTCAACCCCGCTATCCCCCACCGAAACGCGTGTTATCT
GCCGCGTCTGCGCGAATTATGACCTCTGCAGCAACTGCCACACCCTTGGC
CGCTCCTCGGACTCTCACGAGGTGCAGCACGAAACCCTGATCCTCTACCC
ACCCACCAGCATCTCCCGGGACTACCACGTGCCTCCAGCTCCTCCACCCC
CGCTCCCTCCTCGCTCCGGCAACAACATTGGAGAGACTAGCCCGCATCCG
TGCCCCGCCCCGCTAGCGGCCCGCATTCCCACCGCCGCGAGCAAGCTCCT
ATCGAGCAACAACACCCCAACGAGGCGCCTAAAGGACCTCTCGGATGCGG
TCTTCGCACATGTGAGCAGAACCTACCCCGGTGCGAACCAGCACTTACTA
AACCCCGGCCAAATATCGAATTTCTACGAACTCACTGGGAAACCACTCAA
GGAGAACTCGTTCGGCTTGTGGATCAACGAAGCGGATGGTGGTCCCAACA
ATACAGATCCCGAGGTCGCGCATCTCTACGATCGCCTGGGGATCGAGTAC
TCGCTCATCACGCGCGTCACTGGAGGGGGCTCGCAGGTGGCGATAAATCG
CATGCCCGTGCTCAGTCACCGCGGCTTCAGGCAGCTTCTGGTCTGCGAGA
TACTGGAGGACCCGGGGCACGCGCACTCCTTCTTCAACCGGTTGGTACGC
CTGGCGATAGTTGATGACAGCGGACGGGCGTTCGGGGAACTACCTCGGGG
AATGTTCCCGGCAGAGCCTGACCCGGCTTTCGTGGCCAAGGTCGCAGCGG
TCACGGATGAATTGTGCGCGCGCGTGAAGGCACTTATTGCCAGGTTGAAG
CGTG

Sequences in the Contig:

SY0AAA58YN14FM1 SY0AAD36YN04FM1 SY0AAD44YH22FM1