Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1691
Length(NT) : 1273
Best Gene Model Blast : Link to GSTUMT00002833001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62539.1| Score: 214 E_value: 5e-22
KEGG Definition: dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases)
Accession: aor:AO090701000892 Score: 214 E_value: 2e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 214 E_value: 5e-18
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 132 E_value: 2e-08
Swissprot: Q9Y6Z9|SOU1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1691
TTGGTATTGCTCAGACCCCGCAACCAAAAGTGACACCTCATCATCAGTTC
CTTGGCGGCAATCGGAATGAGTCTCACAGCTCCATCAGAGAGCACACCGC
TGGCCCAACTTTTCTCCCTCGAGGGCAAGGTATGTTTGGTTACCGGAGGT
AACAGGTATGATCCCTCTCTTTTTTTTCCCATCCCCCCGATCCCTCCCTT
CACCCTACTCACCCCCTTACTTGCCACCTCATCCTATGAGTGAACGAGTA
CCTGCGATTGCGAACACGAAAGTGAATATACGGTGTGGTTGCCGAGCTGG
TTAGGGGAATTGGGCTTGCCGTGTGTCAAGGCTACGCGGAGGCCGGGGCT
GCTGGAATCGCAATCATACACTCTTCCGAAGCAACGGCAAGGCTGGCAAG
CGAACGTGCGACTGAAATTCAGCAAAAGCATCCGAAAACGATCGTCAGAA
CCTATCGGGCGAACGTGGCCGTCTCCAAAGATATAGAAGAGGCTACGAAA
CAAGCCTTCTCTGATTTCGGTCGATTGGATGTGGTGGTCGCCAATGCCGG
GGTTTACACAGAAACTCCAACGTTGGAAATGTCATCAGAGGAGGCAGAGT
ATGTTACAGGGGTTAACTACTTTGGCCCCCTCTACACCGCCCAGGCCGCT
GCAAGGTAAGTTGAGATAGATTCAGCAGTGGAAAGGGGAGGAGAAAGTGA
TGGGAGCGAAAGATAAAAAATAAAAAAAAGTAGCATAGCGGAGAGGGTCA
TCTGTTCTTTTTTCTTCTTCAATGCGCACAACTCGAGTGTGAATTTGTTC
TTGGCTAAAACACCACACACCGCAGGGTCTTCAAGGAAAATGGCGGAGGG
AAGATAATCATGACAGCCTCCATAAATGGACATATGGTTCTTCGACCCCA
GTACGAATCAATTTATTGTGCCACCAAGGCAGCTGTATGCCATTTGACTC
GAGCACTCGCCGTAGAGTTCGCCCAATGGAATATTCAGGTCAATGCAATC
AGCCCTGGTTACATTGACACGGAAATGTGGGTGGCCCAGGCCGATTCCAT
TTTCTTTGGAGAGGTAATCCACGGCATTGCATATTTCTAACCCGCAACAC
CACGGCGCAGGACAACTGAGCTTGTAAATGAGAAACCCGAGCTCATAAAG
GCCTGGATGGTGGATTGCCCGGCGGGGCGGTTATGTAAAGTGTGGGAACT
CAAAGGTGTATACGTATTTCTGGCAAGTGGAGCGAGTTCCTACGTGACCG
GGGCGGATTATGTGGTTGACGGG

Sequences in the Contig:

SY0AAA11YO10FM1 SY0AAA25YD02FM1 SY0AAA27YK24FM1
SY0AAA2YH13FM1 SY0AAA30YH07FM1 SY0AAA32YK15FM1
SY0AAA33YD16FM1 SY0AAA36YD22FM1 SY0AAA38YG11FM1
SY0AAA38YJ21FM1 SY0AAA38YM06FM1 SY0AAA40YC20FM1
SY0AAA43YG09FM1 SY0AAA43YH12FM1 SY0AAA48YG06FM1
SY0AAA54YH18FM1 SY0AAA58YN09FM1 SY0AAA63YM12FM1
SY0AAB10YI08FM1 SY0AAB12YK07FM1 SY0AAB13YH03FM1
SY0AAB14YE12FM1 SY0AAB15YO24FM1 SY0AAB17YG13FM1
SY0AAB19YE15FM1 SY0AAB1YE13FM1 SY0AAB29YG20FM1
SY0AAB33YJ23FM1 SY0AAB38YF03FM1 SY0AAB38YF06FM1
SY0AAB40YG07FM1 SY0AAB46YC15FM1 SY0AAB46YN13FM1
SY0AAB53YN16FM1 SY0AAB60YN20FM1 SY0AAD35YE19FM1