Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1690
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00003548001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1690
TTGGCCCTTGGTCTCTTCGCCCTCTTTCCTCCCACGAGTTCCTTTCTTTG
ATATCCCGCTTTCCCCGTTGAGTATTTCATTCTGCAACTTCAAGAAAGTC
TCTTGTTCTCATCTCGAACTGCATCTTACCAACTCCTCCCTGGGAGCACA
TAAAAATCGAAGGGGAACCACCTAGTTTATTGCGACGGGCAGATTCTGTC
AAAGTCGAATCTTCTTACAATGGCTTCGTCACTGCGTGCGAAGTACAAGC
GCCCTTCCCCTCTCGAATTCAAAAAGCCCCTCCCGGAGCCACGTCTATCC
ATATTTTCCACTCTCCCCGACACCGTCTATCACCCGGAGGACGACGAAGT
AGACGATTTGGACGATCCCAGCACACCTGAAACACCAAACGATGCCGCTG
GTATATTCAGAGGCTATTCGCCTTCGAGTTCGTCGAGTTCTCTCAGCGCA
CGCGAGATCAGCCCGCCTATTACTCCAACAAACGAGGTGTATCATGGAAG
GAAAATCAAGAGAAAGGGTTCGAGTGCAAATATGCGTGGGAGCCCTGGTA
TTAACTACACAAATAAAGCCCGTCTCAGCAAATATGCTCATCAGGCGCCT
ACAACTCCGACTACTCCTCTGTCTGGTCTCGATGCTTTTCC

Sequences in the Contig:

SY0AAA14YM17FM1 SY0AAA58YN06FM1 SY0AAC57YI09FM1
SY0AAC57YO13FM1