Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig169
Length(NT) : 1069
Best Gene Model Blast : Link to GSTUMT00005393001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 212 E_value: 7e-18
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 150 E_value: 1e-10

Sequence:
>Contig169
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGGAGTCGGTAGAGAGGCTG
GAGGCGGAGGTGGAAAGGTTGAAGGAGAAGGAGAAGAAGCTTAGCGAAGT
TACTGTTCAGAAAGATGAGGCGCAGGAGACTTTGGCCGGTGTGAAGACCG
AGCTCAAAGAAGCTGTCGAGAGGGCTGAAGCTGCGGCTACCGAGAGGAAG
GCCCGGGAAGAGGAGCTTGAGAAATTGAAATCAGAAGTTGCAACCCTCAC
TCGGCAAATGTCACATCTCACATCCCAGATTTCGCAGAAGGATAAGGCTA
TCTCGGATCTAAAGCTCCATTCATCTTCATCTTCTTCGACGCAGGATAGA
GAATCCCTCACCGCAAAGGAGGATCAGATTGAGAATATGGAGATGGACAT
AAGCAAGCTTCGAGGTGACCTCGAGAGAGCTAACAAGAGTCTTGCCGAAA
GTCAATCCGCGCTTGCTACTGCTGAGGGCAAGGTGAAAGGTCTGGAGGAA
TCGCAGGAGGATGTTGCAAAAGAGCTTGAGGAAAATAAGAAGAAGTTAGA
TAAAGCTGCAGAACGCCTTGTTGCCGAGGGTGCTGCTAGGAGCTCTGCAG
AGACCAAAATCACATCTAGAATCCGAGAATGCCACCCTAAGGAGCTCTCT
CGAGAAGGCCATCAGCGACGCAAGACGGGGCACCGGCTCAATGCCGCAGG
ATGACGAACTCGTCGACGAGCTCGAAGACGATGGACGTAAACGCTTAGAG
GCAAAAGTCCGGCAATTAGAGCAGCAATTGCAGCAGGAGCGCAGCCGCTG
GTACACTAGCGAGAAGCAGGGGCTAGCGTCTGCATCCGCACCCCCGCGCT
CTACCCAGCAGCACCAACAGGAATTCTTGGACGTGGACTTGAACGCTGGT
GACGGCCAGCACCACCCGCGTGGTGGTGGCAACGACCATTTATACGCTGC
GCAGATGGAGGAGGAGAGGAGGCAGATGGAAGCGCAGAGGCTCGAGAGGA
TCAAGGAGGTCAAGCGGGGTTTGGCGAATTGGAAGGGGTGGAGGCTGGAC
ATGACGGCCGGAGGGGGGT

Sequences in the Contig:

SY0AAA16YB05FM1 SY0AAA42YC23FM1 SY0AAD26YB04FM1