Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1689
Length(NT) : 1344
Best Gene Model Blast : Link to GSTUMT00010478001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001537511.1| Score: 171 E_value: 3e-10
KEGG Definition: hypothetical protein
Accession: ani:AN5180.2 Score: 146 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1689
TTGGGGACCGACCTGGGATTGTGCCCGACGCCTAAACTGAGATGCCCGAG
GCGGAAGGAAATTTTACGAAGGGGAAAGGAGAAGTACTGTGTTCCGTTCG
ACAAGAGGTGGCGAGTTCAGGATCCGGAGGCAAGCCAGGGGAATCCAACA
CTCGCACTGCTATCTCCGCACGAGCTTCAACAACGTCGAAAGTGGGAGGA
GACAGAGGGGCTTTTCACTTGTGACAACTGCGAGGCTCGGATACTGGACC
GCTGCGAAGCATGCGTTTACCAGATGACTTGTTCAAACTGCAAGAAGGCT
ATTTGCCACAGTTGCGCTTATGATAGACCAGCCGGACCTATTGCCCCTGC
CGAGACTGTTCCGAACGGAGCCCCTGGTGTTCTGCCTCCACTTATGGCCC
CCGAGGGTCCGTGGCCGAACCCCACGACTGCGGGAATATCGGCGATGGCA
ACTATGGCCCCCCAAATAGGTGTGAATGCGAATGGAAACGGGAATGGAAA
TGGACCCCAATTTCAAGTCGTTCTCGCTACTTTAATCCAGCTGGACCTTC
CGGTTCCCGGTGCCCCGACTAACATCCCTCTTGCGCCTACCTTTTATCAA
CCCACTGTCCCCAGCGCTACCGAAACTAATCCCGTTGTGCATTTCCTGCA
GCCCTGCTGTCAGACCGTTACTCCTAATTCTGCCGATATTCTCTGTGGAA
GCTGCATGACGTCCATCTCTTGGGCTCACTGTGACTGTTGTGGCAAACAG
ATCTGCATTAAGCACGAGTTGTCAGGGTCCCGGAGGTGTCGTGGCGGCTG
CGAGAAGGTGTTCTGCTCATCCTCCGACGCGCCGTCAGCTCCTATCGGCT
GCGGCGATCCAGCGGAAGGAAAAGCAGGGATAAAATCCTGTCTGACCTGC
GGAAACGACGTCTGCGCTGATTGCAGACTTGACTCCCTCCACGCACCCCC
GTCATCGGACGACGGCACAGAATCAGAAGTGGAGGAAGCAGCATTGGAAA
AGTGCGCTTGCGATTGTAAAGTCTGCCAAGACAACTTTTACTGCACGGAT
TGCTGGCCAAAAAAGACTACCAAATGCGAAACAAGGCATACTAAGTTTGA
CCACAAAGTTAGGGGAATCATCAACCATAGGTCAATCGACCCGGCAAAGG
ACATAAACCTTTACCTCGTCACATTCGTAGACGTTCCGGACAAGAAATGG
GTGACGAGAGCACGAATTGAGGAAGACTACGGGTCAGATACACGCATACT
CTCAGCATACTCCCCCACCGATCCACCCCCTCCGCCACCAACCCCAGAGC
TCACAGATCCAACAACGGAACCCGAACCCCCCCAAGAAGACGAA

Sequences in the Contig:

SY0AAA48YC23FM1 SY0AAA58YM12FM1 SY0AAC19YE02FM1
SY0AAC45YH02FM1 SY0AAD48YD16FM1 SY0AAD52YD22FM1