Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1688
Length(NT) : 784
Best Gene Model Blast : Link to GSTUMT00000409001 E-value : 1e-177
Numbers of ESTs : 55

Blast Results:

Nr Definition: Histone H4.1 sp|Q76MU7|H4_ASPOR Histone H4 emb|CAA39155.1| H4.1
Accession: sp|P23750|H41_EMENI Score: 409 E_value: 3e-38
KEGG Definition: hypothetical protein
Accession: ang:An08g06940 Score: 409 E_value: 1e-38
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG3467 Score: 504 E_value: 7e-52
PFAM Definition: Histone, Core histone H2A/H2B/H3/H4..
Pfam Number: pfam00125 Score: 153 E_value: 3e-11
Swissprot: P04914|H4_NEUCR

Sequence:
>Contig1688
TTGGACCAACGACTCTCTAACCAACACAACAACCTCTTTCACTACTACCC
ACGCCAACTACCACCACTAATCTTCAAGAGACGAATTATCCTTTCTCCTT
CAACCTTCACTAGCTTTCGCTTTTAATCCACAACACAACAACTATCAATC
AATATGACCGGACGCGGAAAGGGCGGAAAAGGTCTTGGAAAGGGAGGAGC
AAAGCGTCATCGCAAGATTTTGCGTGATAACATTCAAGGTATTACCAAGC
CAGCCATCCGTCGTCTCGCTCGTCGTGGCGGTGTCAAGCGTATCTCTGCC
ATGATCTACGAAGAGACCCGTGGTGTCCTCAAGACCTTCCTTGAAGGTGT
CATCCGTGATGCAGTCACCTACACAGAGCACGCCAAGCGCAAGACCGTCA
CCTCTCTCGACGTTGTCTATGCCCTCAAGCGCCAGGGCCGTACTCTCTAC
GGTTTCGGTGGTTAAACATCCTTCAATTTCTTGTTTTTTTCGGTGTTTTT
TCCAAAAAAAGGGATGATGGGAGGGAACTTTCAATGCGGGTGATGTTCGA
GCTTTTTCCTTTTGTTGAAGAAATCTTTTCCCTTGTTTCTTTTACAGTCG
AGGAGGGGGAGGCTTCGTGTTTCGATTTGTAATAGCTAGTCCATGCGCTA
CGGTGATTGTTTTATGCTTGTCTGGATTCTGAATAATTGGGTTCTACATA
CAATCTTTTTTTCTTTCGCGCGCAGTGCTGTTCTAAAAGTTCATGTCTGC
TCTCAAGACGAAAATGCAAAAGAAGCATAAAAAC

Sequences in the Contig:

SY0AAA10YO22FM1 SY0AAA10YP01FM1 SY0AAA17YA06FM1
SY0AAA17YG22FM1 SY0AAA17YG23FM1 SY0AAA19YO05FM1
SY0AAA27YG06FM1 SY0AAA28YM15FM1 SY0AAA34YA04FM1
SY0AAA35YO11FM1 SY0AAA36YO06FM1 SY0AAA40YN02FM1
SY0AAA44YD09FM1 SY0AAA58YM04FM1 SY0AAA61YE05FM1
SY0AAA62YJ17FM1 SY0AAA7YC08FM1 SY0AAA7YP13FM1
SY0AAA8YC03FM1 SY0AAB10YK18FM1 SY0AAB11YF05FM1
SY0AAB13YD12FM1 SY0AAB1YD20FM1 SY0AAB24YB22FM1
SY0AAB29YN02FM1 SY0AAB30YO02FM1 SY0AAB34YA05FM1
SY0AAB34YL05FM1 SY0AAB37YD10FM1 SY0AAB38YL09FM1
SY0AAB41YA18FM1 SY0AAB41YI02FM1 SY0AAB42YD05FM1
SY0AAB43YO19FM1 SY0AAB51YF12FM1 SY0AAB52YH22FM1
SY0AAB52YO08FM1 SY0AAB55YI09FM1 SY0AAB56YH02FM1
SY0AAB57YK05FM1 SY0AAB5YM08FM1 SY0AAB61YA12FM1
SY0AAB61YM22FM1 SY0AAB7YE20FM1 SY0AAB7YI20FM1
SY0AAC24YJ09FM1 SY0AAC3YD03FM1 SY0AAC40YI18FM1
SY0AAC60YF10FM1 SY0AAD10YG10FM1 SY0AAD38YO17FM1
SY0AAD46YA23FM1 SY0AAD47YI24FM1 SY0AAD58YM22FM1
SY0AAD6YD24FM1