Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1687
Length(NT) : 1199
Best Gene Model Blast : Link to GSTUMT00004053001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1687
TTGGCCTCCTCTGTACTGGGGGAGAGTCTGGTGTTTGTCAGAATACCGGT
AGCAAGGGAAACGCCCTGCAGCCGTCAACTTTCAAGGAAATCAGCTGTCT
GTGTCATCATGGGATCTGAAAGTGAAGATGGGTATATAAACGCCATGCCC
CAGAACTGTGGACTCGACTTTCGATAATAATCACGTTGGGCACCCTTCAA
TCAACTATCAGCTTCCTCTCAGGAGAACATCGCTTCTTGTACTGTACTGT
ACGCGTGCTGTAACACCTTTTCTCTCACCCGATCAAGCCATTCATCTCTA
GGCCACTTAACAGAAAAAGCAAAGGAGAAACATACCGCAAAACACATTCT
ACAAGTTTGCTCTGTTACCTTTCTCGGACCGCCGCATAACTTTGTTGTTC
ACTCAACCCCGCTTTTCTCTCGAGGAGGTTTTTTAAAACCCCCTCATCCG
TTACCAAAGAGCCTAGTTTTCCTTCGCTCTAGAAACCCGCCACCAGCGAA
TCCTTTATTCTATCATTTTTGGAACTCCCAAAAAAAGAAGTCTAGACATG
GCAAGGTACACTACCGCAGACCCCTACATGGGAGAAAGAGAACGACAATA
TCTTTCAGATCGTGCTCTTGATACTCAGATGGCTGTATACTCGCCTGATA
CACCTTTCAACAGTATTTCTACTATCACTCCATACACTTCCTACGGAAAC
CCGCATACTTCCACGGGTGCCCTTGTACGCGGCGGTGTTATCGATGAGCC
CGTTGTCGAACATGAACACCATCACGTTCATCACCATATCGATCATGGCA
ATCCGGTAGCCGGTGCTCTTGTCAGGCCCCGTGTTGCACGCGAGTATTCC
TATGACGACCTTCACGACCGTGAACGCAGATATGGTAGTGGTATGAGCTT
GGGTAGTTTTGGCCACCACCATGGCCACCACTATGGGCACCGTCATCGTG
GGCTCCTTGGGGGCCGGTTTGCCCGATCAGATATCGATCTCAACCTGGAT
GCATCATATAGGCATCGGCGAAGAAGCATCTATGATGATAGAGATTCGGA
ACTTGCAATTATTGATGTTCCTGCTGGAACCCGTCGAGTGACTGTCGACA
TGGGTCGGGAGGTTGATATCAACTGGAGGCGGGATAACGGCGTTCGGAGA
TCAAGGGGATTGGGGAGTGAGCTCTGGACCGAGATCACTAAGGACCTTG

Sequences in the Contig:

SY0AAA11YD09FM1 SY0AAA58YM02FM1 SY0AAA61YM05FM1
SY0AAA62YB17FM1 SY0AAB29YD13FM1 SY0AAB33YL24FM1
SY0AAB55YL23FM1 SY0AAC14YM12FM1 SY0AAC25YD17FM1
SY0AAC40YH09FM1 SY0AAC51YD06FM1 SY0AAC5YH22FM1
SY0AAD19YN24FM1 SY0AAD20YE10FM1 SY0AAD32YO16FM1
SY0AAD34YE06FM1 SY0AAD47YM20FM1 SY0AAD51YF19FM1
SY0AAD57YE23FM1 SY0AAD59YE10FM1