Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1685
Length(NT) : 793
Best Gene Model Blast : Link to GSTUMT00007220001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 541 E_value: 1e-53
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 497 E_value: 9e-49
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 284 E_value: 2e-26
PFAM Definition: No Hit Found
Swissprot: Q71S21|INVSB_XENLA

Sequence:
>Contig1685
TTGGATCCACCTTCTGCAATATCCCGAGCGAAAAATGTCTCAACCTTTCA
GCAATAATATCGACTCATTTAGCCAGTCCCACAGAACACCATTGTGGTAT
GCTGCTACATATGGGCACGAGGAAGTGGTGAAAATACTGCTCGGACGGCG
AGATATCAACCTCGAGAAACCGGATCCGGACGGCCGCACACCACTCATGT
ATGCTGCTAACAGCGGGCACGAGGGAGTGGTGGATGCACTTCTCGGACGG
CACGAAGTCAACCCTGGTAAATCAGACCGGTATGGGCTAACACCGCTCCA
TCTTGCTGCTATGAATGGGCACGAGGGAGTAGTAAAAGTACTACTCGAAC
GAGTTGAGGTCAGCCCTAACAAGCCAGATAATTACGGCCGAACACCATTT
TCTTGTGCAGCTAGGGGTGGGCATGAGGGAGTGGTGAGAATACTGCTCGA
ACGGGGAGACGTCAACCACGACAAACCAGATGATTGCGGCAGAACACCAC
TCTTTTGCGCTGTTCAGAGTGGGAATGAGGGAGCGGTGAGAATGCTACTC
GGGTTGGACGAAGTCGACCCCGACAAACCAAATAACGATGGCCAAACACC
ACTCTGGTGTGCTGCTTTTCGTGGGTACGAAGGAATGGTAAAAACACTGC
TCGGACTGCATGAGGTCAACCCCAACAAACCGGATGACGACGGCCGAACA
CCACTCGCTTGTGCAGCTGGGGGTGGGCACGGGGAAGTGGTAAAAATGCT
GCTCGGACGGGGCGACGTCAATCCTGACAAACCAGATATTTAC

Sequences in the Contig:

SY0AAA38YD05FM1 SY0AAA58YL18FM1