Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1684
Length(NT) : 1175
Best Gene Model Blast : Link to GSTUMT00003721001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 141 E_value: 2e-09
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 113 E_value: 3e-06

Sequence:
>Contig1684
TTGGGCGATATCCAACCTCCCCAACTTCCTCAACCTGGTAGGGAGCCTCC
TCATCCTCAACAGGCGTCACCACTTGGACCGAATCCTTCACCAGCCGCAC
GAGTACTGCGTAGTAACAGTATCTCCAAGAGTGGTGGTGGAACTCCGGCA
GCAGCGCCAGTTTCCCTGCCACCAATGGGGCCTGGAGCTCCACCCCCGCC
CTCTCGGATGATGCCTGGACCACCACCCCCTCCCGATCCGCAGTCACCGG
AGGTCCGCCCTCGACATCCTGAACAGAATCAGGATGATGATATGGATCTT
GATGAACTTAGAAACCGTCTTTTCGAGGCAAACCGGAAGCAGGCTAAAGT
CACGGCGGAGGTTAATGGTTTGGAGGAGCAGGTTCAAAAATTAGAAAGGC
AGGAACTGTTGAGGCAGCACGAGATGGATGTTCGAAGATTCAAGGGAATT
GAGCAGAGTTTTGTTGCAGAGAGGGAAAGGCTGGTGTCCGAGATCATGTC
GCAAAAGGCGTGGAACAACGACCTTCAGCGCGGAAATCTGGAATTGCAAG
ATATCAAGGGCAAGTTGGAAATCGATGTCGGCCGACTCTTGGACGAGAGA
AACCATGCCATCCATGCTCTTCGACACCATGAGGCCAAGCTCTACACGAT
TACCCAGGCCTTTGAGATTCTAGGTGGGCCTGAGGCTCGTAAGAGGGCTG
CCGCTGCAAAGTACGGACCGGCGATAACGTCGCCTACTGAGTACGATCAT
CGCTCTCATAAAGACAAGGAAGATCTTGACTCGTGGGTCAACAAAAAGTT
TGCGATTGATGCTTCTAACGAGGGTCAACTAAAGAACCTTGTGACTGATC
TTGCGAATGCCGGCGTGTCTGATTTTGGCAGTAAAATTAGGAGCCTGGAG
GTGTTTGTGAACGGTATTAGTGTGGAAAGGGAGAAGCTCCAAGCGGAATG
GACTTCAAGGCTGTCTTCTCCCTCTAGAAGGGAGACACAGACTCCGGAAG
CGGGGAAGTCGCATGGTTCTTATACAACCTCTGATAAACAGACTCCCCCA
GCCACCACCACTGCCGTAACAACCCCCCAAGAGCACTCTCCTCTGCAGCA
GCTGGCCAAGTCCAATTCTAAAGTTAAACCAGATCCGAGCCGCCCCGCAA
CTCCGGAAGAAAGGGCTGTCCGAGG

Sequences in the Contig:

SY0AAA28YL21FM1 SY0AAA37YA12FM1 SY0AAA43YN18FM1
SY0AAA58YK19FM1