Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1683
Length(NT) : 766
Best Gene Model Blast : Link to GSTUMT00006226001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: 40S ribosomal protein S0
Accession: ref|XP_001213256.1| Score: 995 E_value: 1e-106
KEGG Definition: 40S ribosomal protein S0
Accession: afm:AFUA_3G13320 Score: 988 E_value: 1e-105
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0830 Score: 717 E_value: 1e-76
PFAM Definition: Ribosomal_S2, Ribosomal protein S2..
Pfam Number: pfam00318 Score: 577 E_value: 2e-60
Swissprot: Q01291|RS0_NEUCR

Sequence:
>Contig1683
TTGGCCCAAGGATAGCCATCGATTAACACCCCTCTCCCTACCAACCGCGA
GGGATCACGAACCAAGGTCCCACTATCGAAAAACCTGAACAATATGGCTC
CTACTACTACAAACCTTTTTGATGCGACAACCCAGGACATAGAGATGCTC
CTGGCTGCTCAGGCTCATATAGGAGCAAAAAACTTGCAGGTTCACATGGA
CCCCTACGTCTGGAAGACGAGACCTGATGGTGTAAACATTATCAACATCG
GAAAGACCTGGGAGAAGATTGTTCTTGCTGCTCGTATTATCGCTACTATT
GACAACCCAGCCGATGTCTGTGCTGTGTCCGCCCGCTCTTTCGGTCAGCG
TGCCGTCTTGAAGTTCGCCACTCACACCGGCGCAACTGCTATTGCAGGTC
GTTTTACCCCCGGTAACTTCACGAACTACATCACCCGTTCATTCAAGGAG
CCTCGCCTCATTATCGTTACCGACCCCCGGACCGACGCTCAGGCTATCAA
AGAGGCTTCGTATGTTAACATCCCTGTTATCGCTCTGTGCGATACCGACT
CCCCTACCGAGTTTGTGGACGTTGTTATCCCCACCAACAACAAGGGTCGT
CACGCTATTGGTCTTATCTGGTGGATGCTTGCTCGTGAGGTCCGCCGTCT
TCGTGGGATCATCCCATCGAGGGATGCTGAATGGGACGTCATGGTCGATC
TCTACTTCTACCGCGACCCTGAGGCCGAGGAACAGAAGGCTGTTGAGGAG
GCCGACAAGGTCCCCG

Sequences in the Contig:

SY0AAA58YK18FM1 SY0AAA63YG08FM1 SY0AAB10YO02FM1
SY0AAD16YH08FM1 SY0AAD22YH02FM1 SY0AAD45YH15FM1
SY0AAD58YL14FM1 SY0AAD7YG12FM1