Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1682
Length(NT) : 635
Best Gene Model Blast : Link to GSTUMT00010757001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_06966
Accession: ref|XP_001797323.1| Score: 166 E_value: 7e-22
KEGG Definition: hypothetical protein
Accession: ang:An15g06180 Score: 171 E_value: 8e-20
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, Nuclear structure].
Kog Number: KOG2274 Score: 162 E_value: 2e-12
PFAM Definition: No Hit Found

Sequence:
>Contig1682
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCTCGAGCAACCTTTACA
GCTTTTCGTCCTTCGTTTTTTCTTTTCATTTTTCCTTATCAATTGCTCCT
TGCTACCCTTGTTAGACTATACCTTAGTTTGTTGAATCTCGATAGTAAAG
GGACGATCCTCCCACCACACACTTCTATCGACGTGCTTATCATGGAGCAA
GAGATCCTCCATTTGCTGGGTGAGACTTTGTCCGCACAGGAGGGACCTAG
AAGGAACGCCGAAGCTCAGATAAATAATTTATACGGGAATGACGCGCTTC
CCCTGGCTTTGATCCAAGTTGCGTCCACCGCTCACCTTAATATAACTGTC
CGTCAATCAGCCTTGCTGGTCCTGAAGAGATGTCCAGCATTGTTGGAGTG
ATGGGTTCGAAGAATTTACGGGACCATTAGCGGGCGATGGGATTAAAGAC
CGATTGAGGGACCCTCTTCTTGGCTTAGTTACGGACGAGCAGAGGAAGAT
TAGGTTTGCTGCCTCGTCGATTGTTAGCAAAATTGCTGGTGCAGATTTCC
CCGAACGCTGGCCGAATCTCCTACAGGGTCTACTGAATGTTATCAATACG
AAGACCAGTACCGAACACCAGGTACATGGTGCCCT

Sequences in the Contig:

SY0AAA38YE01FM1 SY0AAA58YK17FM1