Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1680
Length(NT) : 749
Best Gene Model Blast : Link to GSTUMT00010206001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57187.1| Score: 368 E_value: 2e-33
KEGG Definition: mRNA capping enzyme, guanylyltransferase (alpha) subunit [EC:2.7.7.50]; K00987 mRNA guanylyltransferase
Accession: aor:AO090001000697 Score: 368 E_value: 8e-34
KOG Definition: No Hit Found
PFAM Definition: mRNA_cap_C, mRNA capping enzyme, C-terminal domain..
Pfam Number: pfam03919 Score: 202 E_value: 7e-17
Swissprot: P40997|MCE1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1680
TTGGCAGCAGAGGAAAATTCAATCGACTTCCGACTGAACCTCGAGTTTCC
GCTTATTTCTCGGGAGGACCTCGAAGACGATGACGAAGATGAATCTGACA
CAGACTCAATGACACCTGATTATGATGCGATGCCCAAGTTCAATCTTTCG
GTCTTTATGGGTGAGGAGAGGTACGAGAAATGGGCAGAGATGTATGTTAC
GCCTCAGGAGTGGGATGAGTTTAAGAGCATGGGAAAACCTCTCGATGAGG
AAATTGTTGAGTGCGCGATGGACGACCAGAACAGATGGAGGTTCTTGAGA
TTAAGAACCGATAAAAAGGATGGCAATCACATTTCGACAGTTAACAGCGT
TATCGAGAGCATCAGAGACAGGGTAGGCAAGGAAGATTTGATGGGCGCTG
CTAAGGAGATACGAGATGCTTGGAAGGCTAGACTTCTCGGGAAACAACAG
CACTAGGAGTAGCTTTTTTCTTTCTTTCTGAGTCACTGGTTGTTTGTCAA
GGAGTGGGATTCAGCATTTGCTTTCGTTCCGGTGTTTGGGATCAGGCCTT
TTTGTTTGCTGTTATGGTTGGGTGTCTTGCAAGGTGTCGTACGGCAATCG
GGTATTTCGCTATGGACGGTTTTATTACGATAAATCATGGGGGTGGGAAT
TTGCGTGCGGGTCTGTTTTGAGGCGGCGATGGCTTTTTGTTTTTAGTATT
CCATTTCCATAGATAAACTCAACCCGGAAGAGTGTTGATGTCAAATTGG

Sequences in the Contig:

SY0AAA24YK05RM1 SY0AAA58YK04FM1