Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1679
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00011327001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_14208
Accession: ref|XP_001584925.1| Score: 174 E_value: 4e-11
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_6G02260 Score: 183 E_value: 2e-12
KOG Definition: No Hit Found
PFAM Definition: DUF1690, Protein of Unknown function (DUF1690). Family of uncharacterised fungal proteins..
Pfam Number: pfam07956 Score: 143 E_value: 4e-10

Sequence:
>Contig1679
TTGGCGTCATTTCAAGCACCACCACTACAATGGGTTCCGGCAACAGCAAA
CCCGCCGAACGTGTTTTCGATGGCAGCGAAACTCCGACAAACAGCACCCG
GGAAAAGTCGTTAGAAATCCAGGTCCAATCCCGCGTTGAGAGCGAATTGC
AGCGTCTGCATTCGCGGGAGTCCCAGATTCTGGTTGATCTGGAGAGTAGG
CTCTCCGAGAGCGATAAGGATGGGGATACGAAGGGGTTAAGTAGGGAGCA
GGTGCAGGCCGAGATCGATGCGCTGAAAGAGAGGTTGGAGCGCATGCCTA
GGATGATCAAAATTGATGGCGAGGTGGAGAGGGCGAGGGGGGAGGTTGTC
AAGTGCTTGAGATTCAAGTGAGTTAAGCTTTCTCATCTCCAAAGGATGGG
GCTGTGGGGGATCGGGGTGGGGGCGGGGTGGTGTAATGGAAGGGGAGATA
TGGCAGAGGGGATGGGGGTGGTAGGCTAATGGAGTGCGATAGTGATCGGA
CACCGTTAGATTGTTACAAAGAAGTGGAGGAGTTCAAAAACCAGACTAGA
CGGATGGAAAAAGAATTCGTTGTCCGGACCGTGGGAAGGGACTACCCGTG
AAAGGGAGCTGATTGGTTTAGGGAGGGATTTTTTGCAACTACGGTAGATC
TGGTGATGGGATAGTTTAGGTTGTTAG

Sequences in the Contig:

SY0AAA58YJ06FM1 SY0AAB3YP10FM1 SY0AAD19YN09FM1