Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1678
Length(NT) : 1194
Best Gene Model Blast : Link to GSTUMT00010371001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_02974
Accession: ref|XP_001243533.1| Score: 366 E_value: 6e-33
KEGG Definition: hypothetical protein
Accession: ang:An01g10060 Score: 364 E_value: 5e-33
KOG Definition: No Hit Found
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 160 E_value: 9e-12
Swissprot: Q9UTN0|YII3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>Contig1678
TTGGAATAATATCCGCTCCATTCCAGATCCAACACTAACCGAAAACCATG
GATTTTTCCCATTACTTTTGTCAGTCCTCTACGCGGGATCGATGTCACTA
CCCGCGAAGGTCATTGAAAAAATTCTTACCGGTCAATCGAAGATCGAGGT
GACCAAAAGCCTCTACTCAGGATCAATGCATGCTCTATCGGCCTCTTCTT
TTCCCAGAACCCCGACTGTCAGTTCGCTCATCGCCTTTCTCATCACTCAA
ACGTGTCTCATTCGGGAAGAGGAGCCATTGACCTCTTGCTCGTTTCTTGG
CATGGCTATGCGTGTCGCACAGTCTATGGGGCTCCATCGCGACGGGAGTC
TGTTTGGTTTGAACGAAATTGAATGTGAGGTTCGTCGGCGTGTCTGGTGG
CACATCCTTTATTTAGATGTTCAAGGGGCTATCGCGACCGGTCTTCCACC
ACTAGGGGGGAGTGGGGAAGAGCTGTTTGACACAAAAATGAACCACAGAC
ATCGGTGAACCATATGGCCCATACCTGCAAGGCACTTCTGGATGAGCATC
CAAATAGCCCTGCAATGATCCTCGCTGCTGGCAGGTATGACATGACGATT
GTCCTAAGGAAGGTCGTCATTCAGCTTCTCTCGACAAGACCGCCGCAGAA
AGCGGATCTTATGGAAATGGGAGGAGCAATCTTCGAACTGAAGCTTAGAC
TAGAGGATCGAATCGCAAGGATTCCAGCTAGGGGGATACCAGAAATGGGG
GTTCACTCCTCCTCACGATCCCGAGTTTCATGAGCTTATGGGGCACAATG
AAAGCTTTTTTGATACTGAAAAGGCAATTGTTTTTAATGGCTGGGCTAGG
ATTATGTTGAGTATGTTTTCGGATAGAACCTTCGGCGTCTTCTACCAATC
ATTTCTGAAAAGATCCAAGAGCAGACTGTGGGATCATGCTAGACATTGCG
CATTGCATTTCTGCGTCTCTTTCCTCCAGAAGTTTGTACATGTTTCGAAA
AACCCACTTTTCCAACCATATCAGTGGTTCTGTCCTGGCACCTTTCAACC
CCTCCATGCTACTATGATATTGCTTATCGATCTCCACGAAAGGCCCCAAA
GTCCTGAAGCTCCGCAGAGCCGTATGTTTGTGGATGAAATCTTTGCCCTC
TTCGGCGAAGATGGAAACTCTTTAGTAGGCGCTCCTGGGGGTAA

Sequences in the Contig:

SY0AAA38YH02FM1 SY0AAA58YI09FM1 SY0AAB12YG24FM1