Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1677
Length(NT) : 1346
Best Gene Model Blast : Link to GSTUMT00007737001 E-value : 1e-40
Numbers of ESTs : 9

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1677
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGACGTGTTATCTCTCCTC
GGCTTCTGATATTATCACCATCAGCTCCGAAATCGAACGGTCGTACGGAA
ATGCTATCCATAATGTTGGAAATATCGAGTGCGCAGCTTGACCGCACTAC
CGTATCCGTGCTACTTTGCGCTAAACTCAACTGCTCGAAGGGGATATACT
CGAGTACAGGGGCTGTGAAGCACCTACTTGAGCTTGGGATTGGAATACGG
TACGTGCGGGCAACAGCGCAAAAGAAAATCGGCCCTCGCTCTGCCGCTAT
TCAAGCAAGTACGGTACGAGTAGAAGTGGCTCGGTTGTTAACTTAAGCTA
CTTTTAGAAGGCATTCAGGTTAACCTACGTGACCAGTCCAACCGAACTCC
ACCACCTAAAAGAGTTAGCCCGGTATTGTTGAACAGCTGTCATGCGCTAG
CGCCGATGTCATGGTTTTCGACTGTCGCAACCAGGTTGCTTCAATTCAAG
CCAGCTGAGAAAGGTCACTATTAATTTGTTGAGATGCTTATAGCCAACAA
AGTTCTTGTCGGCAGCATCGGCATCTTTGCATTGGGCAGCATATACTCGA
GTAGTGACGAAAAAAAGAACAACAAACCAACTTCTCTAGCCCGGTGCCCG
GTCAAATGCGAAAGTGTGGATCGAGACATCACTTCGTCATCAATTTGTTG
GGCACCGCAGAGTGGCTGGGACCGTGTTGCGAGATTCTTGATTGAGGCAG
GAGCGGACTCTACAGAGAAATGCGATTAAGGGCACATACCAATTCACTTC
TCAATACTACCGGTATGCGCTCAACGTACTCGACCCTTCACTCACCATCA
TAGCTTCGAGCAAAGAGCGTTTGAATTGTGGAGAGGGCGGCAGCTGCTGA
CGGAGAAGTGAGGACAAGAGATTCTCAATCATGGACGGCTCTACAATACT
CTACCGTCGAAGGCATTAGAACAGCAATCAAGGTGCTATACGTTTCAGGC
CGCCCCCCGCCGAGATCAATAATGCCTATGAAACTCCTCTCCACACCGCA
GTCGCAAGTACTAGAAGCGACTCGACATACTCATTACCCATAGCTTTAGT
ATAGGAAGGAGTTGTTAACCTGATAGCCCAAGATGAGAGGAAACGAAAAC
TAGTTGATTGGGCAAGAGGCTATAACTAGTTCCAATTGGTAGAACGTCTT
AGGGATGGTGGAGGGGAGGACTTTTTTACAGCGTGAACTTCGAAGGGAAG
AACGCCGAAGAATTTGCAATAGAGAATCTCGCTGAGAATATGTTATCAGG
TGTACGGGGCGGACAGTTTGTATACAAATAGATATTATATCACCTG

Sequences in the Contig:

SY0AAA19YD22RM1 SY0AAA43YE01FM1 SY0AAA54YP19FM1
SY0AAA58YH14FM1 SY0AAA63YH03FM1 SY0AAB11YH03FM1
SY0AAB3YD22FM1 SY0AAB4YI06FM1 SY0AAB51YE02FM1