Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1676
Length(NT) : 1269
Best Gene Model Blast : Link to GSTUMT00003795001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CIMG_05516
Accession: ref|XP_001246075.1| Score: 109 E_value: 2e-15
KEGG Definition: CCCH zinc finger domain protein
Accession: afm:AFUA_2G02160 Score: 109 E_value: 2e-14
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0845 Score: 138 E_value: 4e-09
PFAM Definition: No Hit Found

Sequence:
>Contig1676
TTGGATACTTTGTCAATTGCCAAGGACTCGTGGGGACTCTATGATACTGT
AGCTCGTCCTGCTAGTCACGGGTCAAGGGACTTTGTATCCCATGCAAAGC
CTCAACTTCTCAACCCCCTCGTTACTTTACTCGATAAAATTACAACACCT
TCCTCCTTGGAAACCATACCCCCACGACATCTTCATAATTCCGATTCCAC
GTGCCAAGAAGATTGTCCTCCATCGCCTAACGGCGCATTATCTGCATTGT
TGCATTCAAAATGTCGCAAGTCTGCAGATTCTACCAGCGGGGCCACTGTA
AATTTGGTTCCAACTGCAATTTCCTACACCCAGGTGCCATTACCTCGGCC
CCTAACGCTTTTGGTGGAGCTCGCAATAGTTCGCCCCCCAATTATCTGTC
TCTTCCATCCTTGTCCCCCCTTTCTCCCGGGCTAACTACTATTCTATAGG
TTTCGGTGGTGGAGGCATTCAAACAAAGCTGACCGACGGGTTTACTATCC
CCAGCGCGGATACGATTAGATTAGATCTGAGCGAACGGCCTACCTGGTGC
CTATCAAGCTATGCCCCCAGCAAGGATTCGCCAGCTCAGCTGATCGATGG
GAAAGATATCTCCCCAGAAGAAGCGCGCGTTATGGCATACAGGTTGCGAG
CCGAGGGGATTCCTCAGGCATATGTATGGGGCTGTCATTTTCTGAATCGT
GCGGTGACTAGAGCTGACAAAGCTCCAGGAGGTGGAATGGAATAGATTGA
CGAGTGAAGTGTCGTCACAGATCAGAAATATACTCGATAATATTCCAGGC
GCTATTGAATTTCTCAAGAATGCCCAGGGCGCGCCATCTCGATACAACTC
AGCTCGGGCTTCCAGCCAGCAGCAGACTTCGCCATTTGGTGATCAGAATT
CACAGCAGGGTATTGGTGCTAGCTCGAGTTCAGCTCAGACACCATCATCA
TCACCTTTTGGTCAAGTTCAGCAACCTCGGTCTGCTTCGGGCTTCACCTC
CGCATTTTCCACGCCTACTCCTTTTGGAGCCCGACCCACCCCAGCGTTTG
GCCAAAGCCCATTCGGGCAGCAGGTAGCGCAGCAAACCGCACAACAGCCG
GCAGCGTCGGCGTCGGCGGCACCGGTATTTGGGCAGCCGGCTTTTGGGAC
CCCATCGCAGCCTCAGAGTGCATTTGGCAGACCAGCTTTTGGGCAACCAG
CCTTTGGACAACCAGCTTTTGGTCAGTCCTCGTCATTGGGATCGCAGCCT
TCACCCTTTGCCGCGGCAG

Sequences in the Contig:

SY0AAA58YH07FM1 SY0AAC20YO19FM1 SY0AAC21YO19FM1
SY0AAC58YL08FM1 SY0AAD51YA15FM1