Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1675
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00008458001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_04683
Accession: ref|XP_001795096.1| Score: 929 E_value: 1e-98
KEGG Definition: hypothetical protein
Accession: ani:AN1558.2 Score: 922 E_value: 3e-98
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 907 E_value: 1e-98
PFAM Definition: Myosin_head, Myosin head (motor domain)..
Pfam Number: pfam00063 Score: 641 E_value: 8e-68
Swissprot: P36006|MYO3_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0000146 = Molecular function: microfilament motor activity
GO:0017022 = Molecular function: myosin binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006897 = Biological process: endocytosis
GO:0006887 = Biological process: exocytosis
GO:0006970 = Biological process: response to osmotic stress

Sequence:
>Contig1675
TTGGAGATACTCTGAGTGCCATGCGGGTCATTGGGTTGTCTCAGGGGGAA
CAAGATCAGATATTCCGAATGTTAGCTGCGATTTTATGGCTAGGGAATAT
CCAATTTGTTGAAGATGAGCAAGGGAATGGGGCGATCAGTGATTCGAGTG
TGACTGACTTTGTCGCATATTTACTCGAAGTTGACGGTGCTGCTGTGCAC
AAGGCTCTTACGCTAAGAATGATTGAGACTTCCCGTGGCGGCCGGCGGGG
ATCAGTGTACGAAGTTCCTCTCAACCCAACCCAGGCTACCGCTGTTCGGG
ATGCCCTTGGGAAGGCAATTTACCAGAACTTGTTCGAGTGGATCGTTGAT
CGCGTAAACATCTCCATGAAGACTCGGGGAGCTATTGCACACACAATAGG
AATTCTCGATATCTACGGATTCGAAATTTTTGAGAATAATTCCTTCGAGC
AGATCTGTATTAATTACGTCAACGAGAAACTGCAACAGATCTTCATTCAG
CTCACTCTCCGAACCGAGCAGGAAGAGTATGCACGGGAGCAAATCACATG
GACGCCGATTAAGTATTTTGACAATAGGATCGTGTGCGATTTGATTGAGG
AGAAGAGACCCCCTGGGGTGTTTGCTGCTCTCAACGATGCCTGTGCAACG
GCTCACGCTGATTC

Sequences in the Contig:

SY0AAA58YG08FM1 SY0AAC60YJ01FM1