Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1674
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00011204001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_05921
Accession: ref|XP_001242025.1| Score: 621 E_value: 6e-63
KEGG Definition: cytoskeletal adaptor protein SagA
Accession: afm:AFUA_1G13020 Score: 615 E_value: 1e-62
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0998 Score: 230 E_value: 4e-20
PFAM Definition: No Hit Found
Swissprot: P39013|END3_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0030674 = Molecular function: protein binding, bridging
GO:0000147 = Biological process: actin cortical patch assembly
GO:0007015 = Biological process: actin filament organization
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006897 = Biological process: endocytosis
GO:0030476 = Biological process: ascospore wall assembly

Sequence:
>Contig1674
TTGGCCCAGGTACCTTATCGCCTCATCCAGTATTTCTCTCGACAAACCGC
CTCTACCATCATCACCACTCACGCAATGGCCAACAAACCCATATCACAAG
CGGACGTAGAAAAATACTGGGAAATTTTTAGCGCCCACTCAAAGGATGGT
CAGCGAATCACGGGGGACCAAGCATTCACAATGCTCAAGAACTCCGGACT
GAACGACGCTCAGTTAGCAAAGATTTGGGATCTAGCCGACGTTGATAGGG
ATGGAGACCTAGACTTCGAGGAGTTTTGCGTTGCTATGAGGTTAATTTTT
GATCTTGTTAATGGGGAATACAAACAAGTTCCGAAGACGCTTCCTAGTTT
TCTGATCCCGGAATCGAAAGCACATCTTGTCACAGCTTCTCAGGCGCTGT
CTGATGATCCCCCGCGGTTTGAGCGGATCGATGATGATGAGGACGATACG
CCGGGGCTCAAGGATGGGTTCGATTGGTATATGTCTCCTGTGGATAAGGC
AAGGTATGAGGGGATGTATTCCGCTAATGCTGGGGAGCATGGGCAATTGA
GATTTAATGCTCTTGACGAGTTGTATGAGGGGATCAACGTTCCAGACACG
GATATCCGGTCTGCCTGGAACTTAGTCAACCCTTCCGCCTCGGCAGCGAT
TGGAAAGGAT

Sequences in the Contig:

SY0AAA58YG04FM1 SY0AAB32YE17FM1 SY0AAD13YC21FM1