Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1673
Length(NT) : 756
Best Gene Model Blast : Link to GSTUMT00002672001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_01228
Accession: ref|XP_001560396.1| Score: 338 E_value: 5e-30
KEGG Definition: F-box domain protein
Accession: afm:AFUA_2G02570 Score: 274 E_value: 6e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q06640|YD306_YEAST

Sequence:
>Contig1673
TTGGCACTGCTCGAGCACGGTACTGTACTCGAGTATGACAGCTGCTCGCA
GCTCGCTCCAACAACAAGAACACCACTTAATCCGCCACTCGGCCTCCCAC
AATCTCCCAAGCTTCCGGCCGATCACCCCGCTGCGATGCGCATCTCTGGG
GTGGGAATCTTAGATTCCCAAGAAGATCCTTCGATCCTCGACGCCACTCA
TCAAACCTCCACCAAATCTCCGTCTCTCTCATTGCCTAGCGAGTTGATTT
ATCTAGTCCTGGACTTTCTATCACCACAGGATCAGAAGACGCTAGCTGCC
GTGTGCAAGATTAATCGGCAGTGGTATTTTGCTGCCACCCCTTACCTATA
CCGTCATCCTCAAATCACTTCGGTAAACTACACTAAATTTGTAGCTACTA
TCGCCCCCTCTAGCACCCATGTCAAGCCTTCGAGATTTGCGGGATTGGTC
AAGCGTATCGACCTGTCTCGTATCGTCCACGATAGTACACCGTCGTCAAT
TGCTAGGCTCTTGCGCCGTACTCAAGGATCACTGGAGGAATTTGTCGCCC
CGCAGGCTACCTTTGGATACATAGCATTGGTAGCCGTCGGAAACTGCAAG
CAACTCCGTCTGCTTAACTTGTCTCTCGTCTCGCAATCAATTGCACTCGA
GACACTCTTTCAGCATATTCAGGACCTTCCCCATCTAGTGACCCTCTATT
TCCCCCGGTCCTCAACAGTCGATCGTTGTAAGTCAACGTTCAACTGGCCG
CCCCGC

Sequences in the Contig:

SY0AAA58YF20FM1 SY0AAC57YI10FM1