Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1672
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00011212001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_03095
Accession: ref|XP_001596872.1| Score: 643 E_value: 1e-65
KEGG Definition: small nucleolar ribonucleoprotein complex subunit Dip2, putative
Accession: afm:AFUA_1G02680 Score: 641 E_value: 1e-65
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0306 Score: 680 E_value: 2e-72
PFAM Definition: Utp12, Dip2/Utp12 Family. This domain is found at the C-terminus of proteins containing WD40 repeats. These proteins are part of the U3 ribonucleoprotein the yeast protein is called Utp12 or DIP2..
Pfam Number: pfam04003 Score: 146 E_value: 2e-10
Swissprot: Q12220|DIP2_YEAST
Gene Ontology:
GO:0032040 = Cellular component: small subunit processome
GO:0030515 = Molecular function: snoRNA binding
GO:0000480 = Biological process: endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000447 = Biological process: endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000472 = Biological process: endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>Contig1672
TTGGCAAGCTCCCGGTATTAAGCATGGACATATCTTCAGACTCCAAACTT
ATCGCCACCTGCTCAGCAGACAAAAACGTCAAGATATGGGGCCTAGACTT
CGGCGACTGTCACAAGAGTTTCTTTGCCCACCAGGATAGTGTAATGCAAG
TGGCCTTCGAAAGAAACTCCCACAACTTTCTCTCAGCTGGAAAAGACCGC
CTAATAAAGTACTGGGATGGCGACAAATTTGAAAACATCATCAAGATGGA
CAGCCACTTTGGTGAAATCTGGGCACTGGCAGTAGGAAAGGTTAGCGAGA
TTGTCGTAAGCGCAAGTCACGACAAGAGTATTCGAGTATGGGAACAGACA
GACGATGAGATCTTCCTGGAAGAAGAACGCGAAAAAGAGCTCGAAGAGCT
TTACGAATCAACCCTAACAACCTCCCTCAACCAAGACGAGACCCAGGACG
AGAATGGCCCCGAGGCTACCTCCGCTGGAAAACAAACCATCGAAACTCTC
ATGGCCGGAGAAAAGATTATAGAAGCCCTAGACCTCGGAATGGCCGACAT
GACCATGATGAAAGAATACGCAGCTGCCAAAATCGAGAAACCAAACCTCG
CCCCACCGCC

Sequences in the Contig:

SY0AAA58YE18FM1 SY0AAC6YK17FM1