Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1671
Length(NT) : 1315
Best Gene Model Blast : Link to GSTUMT00005300001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_09329
Accession: ref|XP_001589608.1| Score: 371 E_value: 2e-33
KEGG Definition: hypothetical protein
Accession: fgr:FG08941.1 Score: 359 E_value: 2e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1577 Score: 319 E_value: 4e-30
PFAM Definition: Aldo_ket_red, Aldo/keto reductase family. This family includes a number of K+ ion channel beta chain regulatory domains - these are reported to have oxidoreductase activity..
Pfam Number: pfam00248 Score: 260 E_value: 3e-23
Swissprot: P14065|GCY_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0004033 = Molecular function: aldo-keto reductase activity
GO:0019568 = Biological process: arabinose catabolic process
GO:0042843 = Biological process: D-xylose catabolic process
GO:0009651 = Biological process: response to salt stress

Sequence:
>Contig1671
CGAGACTCTTCAAGCTCTTGTCAAGACCCAATTCCACCCGGGAGTGATAG
GTCGACCATAGTTTTGTGGTGACAAAAATATCCTCCCTCTTTACGCCACC
CCTGAAAGCTTCAGCAAGACCAGCTCCGACTTCATCCTCGTTTCCGTAAC
AGTATGCTGCATCAATGTGTTTGTAGCCACCCTTTAGAAGTGCGTGGGAC
ACTGCTGCCTGAACTTCACCGGGAGCGGATTGCCAGGTTCCTAGCCCAAT
GGAAGGGATCTCAGCTCCCGTGTTCAGCTTGAAGTTGGCCAACTTTTTTG
TACAAAGTTGTCCCCCCAACTTTTTTGTACAAAGTTGTCCCCTTTGGCTC
CCGGTAAGATAGCTGAATCACCATACCACTTTGATTCTTATGGTGCAGGA
CCATGGTGGAAACGTCCAGACTCTCATGATTCTAATGAATTGATGGCACA
AATTTATGAGAATGATGAAGAACATGGGGACTGGAATTGGCTTAATATAC
CAGGTTGGGTTAGGGGGGGTAGTTACAACATTGGTGGGCATTTGAATCTT
AGTGATGGGTCAATTGATGATAACAAATCAATTAAGGATTATGGATCTGT
TGAGGACAGTGGTGATTCTGATGACCGGAGCCAGATGGAGGTAGATTGTG
GTGATGGGTTGAATAAGGGGGATTATGAACCGGGATCCTTTCTTACTCAT
GCGAAGACTTTGATCTTGGGGCCGGGAGCTTCTGAGATGCACGAGTCCGA
TATTCCCCACTATGTTTCTAGCCTTAGTCGTGGACAAGATACAGAGATGG
TCGCAGTATACTATCGCATCCCGGCAACTCATCTTCTAAGTAAGATGTTC
GGCAGATTAGATAATCTAGCCAGTCTTAAAAAATTGGTAATTTCTGGACA
CATCTGGTCAAACCCCTGGCTTTTTGTTCCACGACCTGTCGACTCAGATC
TTAGGTTTCCGAATCTTACCCATCTTACTCTTTCCCTCCCCTTTGCAGCC
CATAAGGAGGCCTCACCTCTACGGAGTCTTCGTTACTTCCGTGAACGCTC
TGCCGATCGACATCTGTGTATGCTTCTCACGGGAAGATACAGAATTCCCG
GCGGAGTTGTGATTGAGAATGGTTCAACTTTCCTCAATACCCTCGAGTAC
CTCCATGTTAGAGGTCCGGGAGCACACTGTTGCTCCCAACTCTGGAAGGG
TTGCTGGAAAAAACTAAACTCAATTATCATTGAACTCCCAACTACGGCTG
CTATATGCGAACCCGGGACAGAGAACCTCATTTCGGCGATTAAAGATAAT
TTTTTGAACCGTCTT

Sequences in the Contig:

SY0AAA20YH03FM1 SY0AAA58YE12FM1 SY0AAC54YO01FM1
SY0AAC7YJ07FM1 SY0AAD17YJ03FM1 SY0AAD18YM18FM1
SY0AAD3YN13FM1