Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1670
Length(NT) : 4524
Best Gene Model Blast : Link to GSTUMT00012164001 E-value : 0.0
Numbers of ESTs : 63

Blast Results:

Nr Definition: G1/S-specific cyclin Pcl5, putative
Accession: ref|XP_001270336.1| Score: 647 E_value: 7e-65
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g512 Score: 633 E_value: 1e-63
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1674 Score: 192 E_value: 8e-15
PFAM Definition: Cyclin, Cyclin. This family includes many different cyclin proteins. Members include the G1/S-specific cyclin pas1, and the phosphate system cyclin PHO80/PHO85..
Pfam Number: pfam08613 Score: 177 E_value: 4e-13
Swissprot: P87049|CGP1_SCHPO
Gene Ontology:
GO:0016538 = Molecular function: cyclin-dependent protein kinase regulator activity
GO:0005515 = Molecular function: protein binding
GO:0000083 = Biological process: G1/S-specific transcription in mitotic cell cycle
GO:0043091 = Biological process: L-arginine import
GO:0000079 = Biological process: regulation of cyclin-dependent protein kinase activity
GO:0007089 = Biological process: traversing start control point of mitotic cell cycle

Sequence:
>Contig1670
TTGGCCGACCGAGAACACTTTTCTGCTCTTCTCGTATAAAGAATCACGCA
ATGAACAAGATACAGCCCACCCGTTAGATTGACGATACGGTTTCTGTCCG
TCAGTCCACTCTCCACTCCACTTTCTTGCCAGTCTCTCTTGGGCCGCACA
ACTCCGCTCTCCGCTCTCTCTCTCTCCCTCCGTTTTTTTTCTATCTCTTG
CTCTCTTGCCTATTGTACGGATACGAGGAGTACGGTACCTTTCTTATTTT
ATCTTAATTTGTTTTTCCATTACCATTATTCCTTTCTGTGACCTTTCTTT
CTGGCCTACTCTATCCTCAACCTTGACAAACTGTCGTCGTTGCCTACGCC
CGAGACAAGTTTGCCCAACGGACTCATAATCCAACTCTCCCTTGTCCACC
GAAACTGTCATCCGTCCGTCATCTGGCCGCTTTTTCGCCACTGGACCCCT
CCCAAGATTTCGCACCCCCTCTAAACACCTTTTTTGCTACCTAAACATCC
TTCCCTTTCCACCCCCCCTCGCCGCCTCAAGCAAGCGCAGGTTTCACTCC
ACTCTCTAACGGCTTGCTCACACTCTCACTGGCAACGCGCCTGGCTCATT
ACTCATTCTCTTTGTCCGTCCCCCTTGCCCTCTCTGTACCTTTTTTAAAT
ATTCAGCTATCGCATCTACTTGCTGCTCTCAGCAGCCACAACTATCCATT
CATATTCACCTGCCATCACTACCTTTTTTGCTGCGCTATTCCTCTTCACT
TTCATTAGCCATTCTCTGTTGCGACAACATACTTGTTCTGTCTGTCAATC
TCTTTGCGGACGACCGGCTCGGTTGCAGCGCTCAGCTCGGAGCCGCCGTG
CCACGACCCAGCCCGGGTGGCCCTAGTGCCTAAACGCCCCCCCGCCCCTG
ATCAACTCAATAGTCCCCCCCCCACAGCCAACTCTACACGTCTCTCTCCC
TACCCTGGTCAAGACTCATTCTCTCTCACTCGATTAGACCATCACGAGGC
GCTGAGGCAAAGTCACAGCGACCTCTAGTTCTCTGAGTCGCCATTTACAA
AAACGCCTTCCATTACAATCGCCGGATATCCTCCCTTCCCAGGTTTGGGA
TATCACAATGCATCCTGCGAAAATCACTGTTGCCGAGATTTCAGTCACCG
CCACCCCTATCACTTTAACTACAGTTGCTGCTGTTGATGAGTTTGGAAGT
ACTCAATCCTAAATTTTCTAAGAGACATAGTTACCTCTTTGTCGATATAT
TCATCAACAGCTTTGGAAAACAACGCAACAAAAAGAAAAAGAAAAAAAAA
ATACACCTTGGGATATAGACGGTGACTGGAATTCTATTCGGGAAAGAAAC
GATTTGCTTTCGTTATTTTAATTCTGGGTTTTTTTTTTTTTACTGAATTT
TTTTCCGGGGTATTTCCTTCTGATTTTCGGCTACGCGTCTTCATTGGGCA
TAAGGAAGTTTCGGTTTTCGGTTGGGCGCCTTGGTTACAGTGGTATTTCA
ATATTCGGATCGTTATTTGGAGGGTTTTCATTGCTTCGACCGACAGGATT
TTTCTACTTCGCCTCGTTAAGTCATAGTCGTCACCGGGCTCACGTCTCCG
ACAACGATATATCGCGAACACCAGCCACTCCAGCTGGTATTCTCTCGTTG
CCGCCACCCGCCTGACGTCCGGTTCATCTTTCGAGCTATCCTGTATCTTG
TCACCATTTCAGTGCTTTCTTTAAGTACAACCTTAGAAAGCCTCAAATTC
AACTAGTACCCTCACCGGGATCGACCTACTTTCCTGAGATTGTCAGTATA
CATACATATACGGCCTTGAAGACGGAATAAGGATTCAGATATTATACATC
CCGGTGCTCCCTGAAAGGGAACCTTTACAAAACAGCTAATATTATATAAC
GCATCTCCACTCAATCCTTTTTTCCTTTTTTTTTCTTTTTGAATCCCAGT
TTTTTTTTGCCCGCAATATGACCCTGGCACATACACCACCCACGGCAACA
ATTACGCACTCTCGTTACTCTTATTCACCTGCGCCCTCAATAGCCTCATC
AGCTTCGTCGTCCCAATCCTCTGGTTGGTCCGTGGCATCGGCGGTATCAA
ACACCACTTCCGTTGCCTCGTGTACCGGCGGTGCCTCGGCTCCAGGGACG
AATATTATCCCCTCCCTGAATATTCAGCGTCAATTTGCAGGCTCGGAGCA
AGATGGTTGGCTACTCCGAAAAAGAGTATCGGTCTCTAGCCTTCGAGGCA
GTGATTCAATTCAACACCCGCACCCTCCCTCAGTTACAGTTGCTCAGGAA
CCGGTGCCCATAGAACAGCGTCGTAACGCCCGGAGAACTAATCGTTTGGT
TGAAGGAGCCAACGCTGGATGTCCTGTATCTGAAGGTTGCCCATTACCTC
CTGTACCTACCTTACAAAGGCAGGTTGATCGGAAGGTTAACTTCGTTGAC
AATCTCGTTGACTCCGCAGCTCAGATTGTCGAGACAATATGGCCGCCCCC
GAAGATGCTTATTTGTGCAACCCCAAAGGATAAGGTTCTTCCGCTCCGGA
CATTCATTCAGGAAACCCTCCGTAGATCCCGGACCAGTTATTCAACACTC
CAAGTTGCTCTGTACTACCTGATTGTAATTAGGCCTCATCTTCCCCCCCG
GGATTGCGATATCAGCAGTTTACCCGCTGAAGAGGCACAGATGACTCGTG
CCAAGCAATGTGGTAGAAGAATGTTCTTGGCGGCTTTGATCTTGGCATCA
AAGTACTTACAAGATCGTAATTATTCTGCGAGGGCTTGGAGCAAGATTTC
AGGGCTGAACACGCAGGAAATAAACGTCAATGAGATGGCATTCCTAGACG
CTGTCAACTGGCGGCTTCATATATCGGAGACCAATTTCCAGAAATGGACT
GATCTGGTATTGAAGTACACATCGGATCACAACCCATCCTCGGCATCTTC
GGCCCGGGCCAATCCGTGGGTTGATGAAGAAGAACGGAAGAGGGAGTGGT
GTGATTTGGTCTTGAAGCTTTCGCCGGATTTGAACGAGGCGGAGTTATTA
GCGTCTGGGGGATTAACACCTTGTGCGGTAGATGCAGACATAGTCGCGTC
CACCTCGCCACTTACGATTGAACCCTTCGTACCTATAGCTCCTGCCCAGC
AGACTCCGGCAGCACCCGTAGCTGCCCAGCCCGTTGCTACACTTGCACCC
CGAGCAACCGAGCACCTTCAAACGTCACACCCCCATGCGTTTAAAGCACT
TCATCAACCCCTCCCAAAGGCGCCTGCTTTCCGCCGCTCATCTTCGTCAC
AACTGCACTCTGGAACAGTGACCCCTGCAGCGGGAATCTGTTCTAGTCGG
CTAGAAGTGACATCTGCATCTCGGTGCTCTGCCATGGCTTCCGTAGCCAA
GATCGCCGAAAATGCGTTATCCGGAGCTACAATGGAGAAGTTCCCATTCG
CACCAAGAAGAGGATCTGATGCGCTACCTCCACCTGTCCTTCCTCCGTCT
CAGGGTGGCTGCATTCGTAGATCATCCTTGTCAGCTTCCGTGTCAAAGCC
TGGTCCCTCAAGCTCGCCAGCATTCCCGAAGGCTAAACAGAGCTGCGAGT
TGAGCAAGCTAGTTTTCACTACTTTTGCCCCTCCTTCACCTAGTTCTGTT
GCGTCATCGGTCAAAAATATTTGCACCAGTCCCCGGAAAACCGGCGATCA
CCGTATGACTCCATGTGTATCGCCTAAATCAAGAGAAGCGGCATTGAGTT
TGAATATGCTCAAGGAGACTTATTCCCCATGCTCGAGCGGTTCAACCACT
CCCACCGGATTGTCGAGGAAGAGGAGCTACCCTGAAAGTGCAATGGAAGG
TCACCCAGGAAGCGCTCTAAGAGTAGAGGCCAATGTTCATGGGTACGCAG
CAGACGGGACTACTAGCGTGACTCCAAAGTTCAAATCACTTAATAGTGGT
TTTCGGTCGCCGTCTCTAGCATATGGATCTCCAACCAGAAGCCCTGCACC
CGATAGGAAAGGCAAGAGATTGAGGTGCGCCCCGGAAAAGAAAATGGGAG
GAATGAATATGATAGAAGGAATGTCGGTGGCACAGAATGTGCGATAGGCA
CAAGTGGTATTGGGTTCGCTTTCATGTAAACATCATTGTGTGCAACCTTT
TTTTCTTATCTTTTTGAATTCTCTGGTCAACCGTTATGGGGGTATTCTGA
TTTTATGGACGTTGCTTTTGTTCCCTTTCGAGGCTTTGTCAAGAGAGGCA
AAATACGGTGTTCTGGTTTTTTATTCCTTTTTCCACTTTGTTTCTGTCAG
GCTTTGTTCAATTCTTTCCTTATCCCACTGCGTTTTTTACATAGCAGATA
ACTAGTCAATCGCTTATTATTTTCTAACCAGCGGGATCAAGCAGATTCCC
TTTTATATAACATCTGCGTTCAAAGTCTTTCAAGCAAGCAAAGGAGAGGT
GCGAGAAAAGAGAAGGTTGATTTTGTACGGACATTTATTTGCTATATGCC
CTAACGGAACAAGGGACAGCTTTC

Sequences in the Contig:

SY0AAA16YP18FM1 SY0AAA1YI16FM1 SY0AAA24YE22FM2
SY0AAA26YE18FM1 SY0AAA26YE18RM1 SY0AAA29YC07FM1
SY0AAA32YE17FM1 SY0AAA35YD01FM1 SY0AAA35YM19FM1
SY0AAA37YJ06FM1 SY0AAA38YF07FM1 SY0AAA38YP16FM1
SY0AAA42YL16FM1 SY0AAA43YN24FM1 SY0AAA44YN01FM1
SY0AAA45YF23FM1 SY0AAA47YG09FM1 SY0AAA52YA07FM1
SY0AAA58YA22FM1 SY0AAA58YE11FM1 SY0AAA59YJ12FM1
SY0AAA61YC20FM1 SY0AAA6YD20FM1 SY0AAA8YF11FM1
SY0AAB12YH05FM1 SY0AAB14YN21FM1 SY0AAB16YO10FM1
SY0AAB18YI22FM1 SY0AAB22YN18FM1 SY0AAB23YD20FM1
SY0AAB26YL20FM1 SY0AAB28YE05FM1 SY0AAB2YN23FM1
SY0AAB30YH02FM1 SY0AAB31YP07FM1 SY0AAB34YO01FM1
SY0AAB40YC15FM1 SY0AAB43YI15FM1 SY0AAB44YN04FM1
SY0AAB45YK03FM1 SY0AAB48YL18FM1 SY0AAB50YD03FM1
SY0AAB53YJ18FM1 SY0AAB7YI01FM1 SY0AAB8YO13FM1
SY0AAB9YI15FM1 SY0AAC10YC03FM1 SY0AAC10YM10FM1
SY0AAC13YC02FM1 SY0AAC2YD08FM1 SY0AAC39YK12FM1
SY0AAC40YK20FM1 SY0AAC45YJ17FM1 SY0AAC47YP18FM1
SY0AAC50YJ08FM1 SY0AAC52YC06FM1 SY0AAC62YJ02FM1
SY0AAD28YD19FM1 SY0AAD30YN01FM1 SY0AAD39YC19FM1
SY0AAD3YJ13FM1 SY0AAD4YP21FM1 SY0AAD53YM15FM1