Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig167
Length(NT) : 671
Best Gene Model Blast : Link to GSTUMT00004713001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62753.1| Score: 708 E_value: 5e-73
KEGG Definition: ubiquitin-protein ligase [EC:6.3.2.19]; K10580 ubiquitin-conjugating enzyme E2 N
Accession: aor:AO090120000129 Score: 708 E_value: 2e-73
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0417 Score: 567 E_value: 3e-59
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 475 E_value: 1e-48
Swissprot: P35128|UBCD3_DROME
Gene Ontology:
GO:0007412 = Biological process: axon target recognition
GO:0007629 = Biological process: flight behavior
GO:0007625 = Biological process: grooming behavior
GO:0007630 = Biological process: jump response
GO:0008594 = Biological process: photoreceptor cell morphogenesis

Sequence:
>Contig167
TTGGGAGAAACATCCGCTGCCGGTATTGACCCTTTGTTAGGGAACTGAGA
AAAAACGCTAGTACAGTACTCATCTCGCATCTCTCCCCTATTCTGCCACT
GCCCGAAAGCCTGCTATACCGACGCCGCAAATACGGACGGCAAACAGTTC
TAACCACCCCACCAAGCTCCCGCCCCACCATCTCCATCCTCAATATACCC
AACAACCCCGCACTCTTTTCGCCCCATCAACCTCATCCTCAACGCTCTGA
TGGCCCTTCCAAAGCGCATAATCAAAGAGACCGAACGTCTGGTTGCTGAA
CCAGTTCCAGGAATTAACGCCGTCCCGCACGAAGATAATTTGCGTTACTT
CGATGTTACTATCCATGGCCCCACTCAAAGCCCGTATGAGGGAGGAATCT
TCCGTCTCGAGCTATTCCTCCCCGAGGATTATCCCATGACACCCCCGAAG
ATCAGATTTCTTACCAAGATCTACCACCCGAATATCGACAAACTTGGGAG
AATTTGCTTGGATGTGCTCAAAGGAAACTGGTCCCCTGCGCTTCAGATCC
GTACCATACTTTTGAGTATTCAAGCTCTCCTCGGGGCGCCTAACCCGGAT
GACCCGCTGGCAAATGATGTTGCCCAGAGATGGAAGGAAGATGAGAGGGC
TGCTATCGAGACTGCAAGGGA

Sequences in the Contig:

SY0AAA16YB01FM1 SY0AAA57YE14FM1