Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1669
Length(NT) : 933
Best Gene Model Blast : Link to GSTUMT00009310001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1669
CCAATCCAATCCTCTCATATAAAGTACGAGACTCTCTTCTCATACGCCAC
CGCACCAGAACTGTGCAAATAATAATAATAAAGTTCGATCACGCTGGCTG
CGCCGCGCGCGTTATCATATATAAATCGAGGGAATCGGGGGATCTTCCGC
CGATTCAACGATCCTCCCTGGATCCAAACGAACAGACGAAAAAAGCACAA
TTTGACTTGGTGTCAGCCATGGCATCTAGCGACGACTACAAATTCCTACT
AAGCTGTTTGATGAACCATACTGGGAAGATCGATTTCGAAGCCGTAGCCA
GGGACACTGGGTATACGAATCCGCGCTCCGCATCCAATAGACTAGCTTCC
ATAAAGAAGAACCATGCTGCCGCCATGGCCGCCGCCGCGGCCTCCGGAAC
GAGTTCCTTGACGGCATCTAGCTCCAAAGAGCAACCGCTGGCAATACCCG
CCGTGCCTCCGCCACAAGCGCAAAGTGCTGCCGAGAAGTCGGCCGCAAAG
CGCCGGATGAGCAAGAAAGCGAAGAGAGGGCGCGAGGGAGAAGGTGGTGG
TGATGGTGGGGATGATGGGGACCCGGAAGTCGTCAAGGGTTCCAAGAAGA
GGAAGGGAACTACAACTGGGGATGATGAGGATACTTAGTCTTTGGCAAAA
ACTGAGGCTGGAGATTTTATGGATGGGGCGATACTCGTGTGGTTGTTCGT
GGTGGCGGTGGGGGCAATAAGTGGATGGGGCTGGGAAAATTATTTTGAAT
TGGGAGGTTTTTTTTCTTTCTTTCTTTTTTTTTTTTTGGTGGGGGACCCT
TAACGATACGCGATATACGTACGTACAGTACATTTACTACACCTATGGGA
TCTTTTTGTTTATTTGTAGGTTTTCGTTTTACGTTACAGGTGTTCAGTTC
AGCTGCAGTAATATAAATTACCCAATTGCTTTT

Sequences in the Contig:

SY0AAA12YF16FM1 SY0AAA32YI22FM1 SY0AAA32YI22RM1
SY0AAA58YD15FM1