Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1668
Length(NT) : 2366
Best Gene Model Blast : Link to GSTUMT00002250001 E-value : 0.0
Numbers of ESTs : 69

Blast Results:

Nr Definition: hypothetical protein NCU01862
Accession: ref|XP_965493.2| Score: 495 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: ncr:NCU01862.1 Score: 495 E_value: 7e-48
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2133 Score: 118 E_value: 2e-06
PFAM Definition: SWIRM, SWIRM domain. This SWIRM domain is a small alpha-helical domain of about 85 amino acid residues found in chromosomal proteins. It contains a helix-turn helix motif and binds to DNA..
Pfam Number: pfam04433 Score: 134 E_value: 2e-08
Swissprot: Q99326|YO338_YEAST
Gene Ontology:
GO:0045944 = Biological process: positive regulation of transcription from RNA polymerase II promoter
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1668
TTGGGTCCTTGTGTCCTGCCTCGCTCCACACACGCAAGCTTAAACACGCA
CTCTTCCACCCTGTCCTGGAGACCTGAAATCATTCATAACGCCGACCACC
CCCCGCCGCCCCATTCCTTCTCCCTTCTTCTTTCTCCTTACCTCGTCCAA
ACCATTCACCAAATACACAATCATCAACTTTACCAATAGCTCACGAACCA
GCAATCCCCTTCAGAGCTTTGTCATTATAGCTTACCCACCATTGGAACTC
ACTACTGGTTGGAACCTGCTTAGGCCATCAATTGAGTTCGCCGTCCTGAA
GCTTACTTCACCCCGTCACTATATAAGCAGCTCAATATTTTTCCGTTGCA
CGTCCCCAGAACCGAATAATTCTGCAACTACAACAGGCTACCGGGTAGAC
CTGTGAGCTTTCCCTGACCTCATTCCCTAAATCCTGTGACGTTAGAAGCT
ATGGAGACAACTCCCACGAGCTCGTCAAAGAACCCATCATCAACCATCAA
CAGCTTCCTAGCTTCACCCGCAGAGTTCCCAAGCTCTCACTTCAGACTCC
CTTCACCGACACCACCAGATCAACCACACATGCCAATTCCCGACATTCGA
TTGCAAGGCGCTCACAAGATGTCGATTGCTGCTGCCACAAACCCACCACC
ATTGCTCTCGCCTCCCCCCTCGCCAGACGATCGACGCCTGTCCTCTCCAC
CGACCTCGAGCCCTCCTTCAATTGCTGACAGACCACTCTTCCCCGTTCAG
ACTAACCCTTCCATCTCGCTAGAGATACCGCTCTTCCAGGTTTCTGAAAG
GTTCGAGCCTATGATTCAAAATGCTATTGCGAGTGCGGACGCTTTTCGTC
GTGGTGTCCAGAGAAAGACAAAGGTCGAGCCTACCGCGGAGGAATACAAC
ATTTTCGTCTCGTCAGCGTGGCGACTTTGCCAGAGTAGGCCAAAGGAGTG
GCTCCGACAGGAGAACGAGTACTTGAGACGCATTGACGGGGCCAGGAAGG
CTGCCGCCGCGGACAGGGTTCAGAAAACAAGTGCGCTGGGTTCCAAGCAA
CGCCTCGCACCTGCCTCCCGCTCGCCTCATGGTTCTCAGTCTTCTGTAAT
CAAGCCACGTATTCATTCCCGCAGACCTAGGACTCCAAGGCCTTCGTCGA
ATGCAATTGATGGCTTCGCCTCGCCCGATGGTCGCTTCCCTACTCCTACC
AGTCAGACTTCCGGATCTGCTCCTACCCGTGCCAGAGCCGTGGCACCAAG
GGAGGATACTGACTTTGAGTCAATCCCTGACATGTCTCCTCCAATCGAGA
CTTTGGATCACCTGAAACCCCTTAAGGCAGACTGGAAAGGCACAGCACTC
GATCTAACAAACGACCCTCACCTGCACTTGCTTCACCCATCCGAAGTTGG
TCTCGCGTCAACTCTCCGTCTCTCGTGCGCTTCTTACCTTACATCCAAGC
GGAGGATCTTCCAGGATAAGGTTGAGAGAGCTAAACAGCACAAGGAATTC
CGTAAGACAGATGCGCAGAAGGCCTGCCATATCGATGTTAACAAGGCTTC
AAAACTCTGGGCTGCATATGAGAAAGTTGGTTGGCTCGACCCGAAGCACA
TTATGAAGTACATCCATTAGAGGGTGCCGGTCACCAAGGGACAGATGTTG
GGGAAGGGAGAGATACTGGGCTCATGGCGGTTGAGATGGATTATGGGAAT
TTTCATACGGGTTCTTATGATTTTACGAATATGGGCTTTTCATCGTCTGT
ACATGTTGGTGCCTGGATAGTTTCATGTTTTCTCTTACTTTTTTTTTCTC
TTTTCCTGTTTTTTCCTTCTCTTCCTACATATTACATGGTCCTTTTTCCT
GTTTGGTTTCTTTCTGGTGTTATTCTTGGGGTACATTTTCAGGCTTCCTG
GGTTTCTTGGTGGGCGGCCGGTTTGGTTTATTCTGCGTTTCTCTTTGTTA
AACGGTTTCGGGCATCTAACTGGATAAGCAACCGGAGTATTGAGACGATT
TGTTTCTCTCTCTTTCTTATTTTTTTATTTCATATATCCACTTCTTTATC
ATAACCTTTTGTACCCTTTCCCTTTGTTGTACTGCACTGCAATATCGGCG
GCGTTCAAGTTTATGTTATTAACCCAGAGAGATTCTGTGGAAGTTTTTTC
TGTCTGTCTCTCTAGACTCCATGTACCAAGTTAGTTAGCTCTCATTCAGG
CGCCTTTATTTGATGTATTTCCGAGGGGGGTTTGCTCTATGGAGTTTTGT
CTTTCATCCTCTTGTTCCGGTCCCCTCTCCCGTTCTCTGGCATTCACGGA
ATACATGACCCGCAACTACTTTGAACTAAATGCATCTTATAATAATACTA
TGTTGAACTTTAATCG

Sequences in the Contig:

SY0AAA12YD13FM1 SY0AAA12YE23FM1 SY0AAA12YJ23FM1
SY0AAA14YB08FM1 SY0AAA15YG20FM1 SY0AAA20YB14FM1
SY0AAA20YF19RM1 SY0AAA20YN09FM1 SY0AAA21YH22FM1
SY0AAA21YH22RM1 SY0AAA26YP19FM1 SY0AAA30YD05FM1
SY0AAA35YL10FM1 SY0AAA37YH03FM1 SY0AAA37YJ22FM1
SY0AAA39YO09FM1 SY0AAA40YO01FM1 SY0AAA41YP20FM1
SY0AAA43YG10FM1 SY0AAA44YH16FM1 SY0AAA45YE10FM1
SY0AAA4YK02FM1 SY0AAA53YD23FM1 SY0AAA53YL10FM1
SY0AAA54YD03FM1 SY0AAA55YM05FM1 SY0AAA57YB07FM1
SY0AAA57YD09FM1 SY0AAA57YM11FM1 SY0AAA58YC21FM1
SY0AAA5YG02FM1 SY0AAA60YK20FM1 SY0AAA62YD15FM1
SY0AAA62YL05FM1 SY0AAA7YL14FM1 SY0AAA8YC06FM1
SY0AAB10YC20FM1 SY0AAB12YA23FM1 SY0AAB17YG15FM1
SY0AAB1YG12FM1 SY0AAB27YN08FM1 SY0AAB29YM09FM1
SY0AAB33YJ21FM1 SY0AAB35YF15FM1 SY0AAB37YH19FM1
SY0AAB38YJ22FM1 SY0AAB40YN09FM1 SY0AAB42YB10FM1
SY0AAB42YL01FM1 SY0AAB46YD19FM1 SY0AAB46YI05FM1
SY0AAB47YI06FM1 SY0AAB49YO08FM1 SY0AAB51YD02FM1
SY0AAB52YL16FM1 SY0AAB54YB12FM1 SY0AAB56YJ22FM1
SY0AAB58YA17FM1 SY0AAB61YG03FM1 SY0AAB6YG06FM1
SY0AAB7YG21FM1 SY0AAC29YO11FM1 SY0AAC31YO12FM1
SY0AAC35YO19FM1 SY0AAC9YI03FM1 SY0AAD27YI24FM1
SY0AAD28YM13FM1 SY0AAD35YG17FM1 SY0AAD39YD24FM1