Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1667
Length(NT) : 735
Best Gene Model Blast : Link to GSTUMT00010415001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: cdk1
Accession: ref|XP_001257919.1| Score: 799 E_value: 2e-83
KEGG Definition: hypothetical protein
Accession: ang:An11g02960 Score: 782 E_value: 7e-82
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0594 Score: 669 E_value: 5e-71
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 446 E_value: 3e-45
Swissprot: P54119|CDC2_AJECA
Gene Ontology:
GO:0004693 = Molecular function: cyclin-dependent protein kinase activity
GO:0008353 = Molecular function: RNA polymerase subunit kinase activity

Sequence:
>Contig1667
TTGGCCTGTGTCTACATCCGCAACCACGACCCAAAACCCAACCACAATCA
CTTGTCCGCAGTCTACTTAACCCTTCGCCTTTCCCGCGGCAGCTCCCTTA
CTTCAAGCTGGAATTACTCTCGGCGTCCAACAATCTCTTTGCTGGTTTAA
CTTGGTTCCGCTCAAAACAAACACCCACTCCTATCTTCTTTGTTTAGGGA
GAAACAATTTGAATCTCTCGGAATGGAGAATTATCAGAAAATCGAAAAAA
TTGGTGAAGGAACCTACGGGGTTGTTTACAAGGCCAAGGATCTCAAGAAC
GGTAACCGTATCGTTGCATTGAAGAAGATTCGTCTCGAAGCCGAAGATGA
GGGCGTTCCGTCCACCGCCATTCGCGAAATCTCCCTTCTGAAGGAAATGT
CTGACCCTAATATTGTTAAGCTCCTTAACATTGTACACGCCGATGGCCAT
AAGCTCTACCTGGTCTTTGAGTTTTTAGACCTTGATCTGAAAAAATATAT
GGAAGCAATTCCATCAGGTATGGGTTTGGGGACCGACATGATCAAGAGGT
TCATGAGCCAGCTGGTCGAGGGTGTGAGATACTGTCATGCGCATAGGATC
CTGCACAGGGACTTGAAGCCTCAGAACCTATTGATAGACAAAGAGGGCAA
CTTGAAACTGGCAGATTTCGGGTTGGCGAGAGCCTTTGGAGTGCCTTTGA
GGACATATACTCATGAGGTCGTCACTCTCTGGTAT

Sequences in the Contig:

SY0AAA21YF10FM1 SY0AAA58YC07FM1 SY0AAB1YJ05FM1
SY0AAC6YP01FM1