Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1666
Length(NT) : 1026
Best Gene Model Blast : Link to GSTUMT00000555001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein SS1G_13990
Accession: ref|XP_001585130.1| Score: 883 E_value: 5e-93
KEGG Definition: BAR domain protein
Accession: afm:AFUA_2G11475 Score: 846 E_value: 5e-89
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3725 Score: 168 E_value: 9e-13
PFAM Definition: BAR, BAR domain. BAR domains are dimerisation, lipid binding and curvature sensing modules found in many different protein families. A BAR domain with an additional N-terminal amphipathic helix (an N-BAR) can drive membrane curvature. These N-BAR domains are found in amphiphysin, endophilin, BRAP and Nadrin. BAR domains are also frequently found alongside domains that determine lipid specificity, like pfam00169 and pfam00787 domains in beta centaurins and sorting nexins respectively..
Pfam Number: pfam03114 Score: 157 E_value: 2e-11
Swissprot: P40531|GVP36_YEAST
Gene Ontology:
GO:0030173 = Cellular component: integral to Golgi membrane
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1666
TTGGTCCCCTCCCCCCCTTCATTCCGTCCTCCGTTTCTCTGGATTATAAA
CCTCCTCTTACGAAGAACAAACCGGACCTGCTGGAATTTTAGTTTACCCC
ACATCGATCCTATCATCGCCTTCAATAAGTATGGATTTCAGCAAGCTTCA
AGGCTTCGGCAAAAACATCTCGTCCAGCTTCACTCCATTCGCTACCCGCA
CCCAGCAGTTTATGCGGGAGCAGCTGGGGCAAGCCGATGAAAAGACCCAA
CTGCCTCCCGATTACCTCGAACTTGAGAAACGTGTCGATGCATTAAAGAA
CGTTCACCAGAAGATGCTGGCAGTTACGGCACAATATGGAAACGAGTCTT
ATGATTACCCACCAAATCTGCGTGAGTCCATTGTCGATTTGTCTCGTACT
ACTTTCGAGAAGGTGCAGCTCCTTGGGAACGCCAGTACCGCTGCCGAAGC
TCAGAATATCCTGACCAAGCCCGGTACCAAAACTGCCCCGAAAACATTCC
CCCATGCCATCGGCCGCGCTTCACTTGCTGCTGCCCATTCTCTTGATCCT
GCCGAGCCCCTCGCCGCCGCTCTTGAGAAGTACGCTCTTGCTAGCGAGCA
AGTCGGTGAAGCTCGTCTACATCAGGATGCTCAGATTGTATCCAGGTTTA
ACTCTGCATTCACTACTACTCTCAACACCAACTTGATGTTCGCTACTAAG
GCCCGCAAGAACGTTGAAAACGCACGCCTCTCTCTCGATGCTGCTAAGTC
TAGAGCAAAGAGCGGTGGGGGTATCGGGTTTCCTGGTCTCGCTGGTCCCG
GGCGCAAAGATGGTGTTGTCGAGGATGAGGGCTTGACGGAAGAGCAGAGA
GTGGAGGTTGAGACCGCTGAGGACGAGTTTGTAGGGTGCACAGAGGAGGC
CGTCGGTGTCATGAAGAATGTCCTTGACACTCCTGAACCTTTGAGGAATC
TTGCGGATTTGGTTCAGGCCCAGTTGGAATTCCACAAGAAGGCTTACGAA
ATATATTCTGAGCTGGCACCTTTGAT

Sequences in the Contig:

SY0AAA35YD10FM1 SY0AAA38YN07FM1 SY0AAA52YG13FM1
SY0AAA54YF20FM1 SY0AAA58YC06FM1 SY0AAA8YO05FM1
SY0AAB2YF15FM1 SY0AAB36YE05FM1 SY0AAB38YI05FM1
SY0AAB48YE19FM1 SY0AAB58YH23FM1 SY0AAB5YO11FM1
SY0AAB61YP17FM1 SY0AAC25YJ22FM1 SY0AAC55YI08FM3
SY0AAC60YI16FM1 SY0AAD1YA13FM1 SY0AAD38YA16FM1