Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1665
Length(NT) : 728
Best Gene Model Blast : Link to GSTUMT00007976001 E-value : 1e-155
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_05492
Accession: ref|XP_001221587.1| Score: 206 E_value: 9e-15
KEGG Definition: hypothetical protein
Accession: ncr:NCU09508.1 Score: 190 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: Polysacc_deac_1, Polysaccharide deacetylase. This domain is found in polysaccharide deacetylase. This family of polysaccharide deacetylases includes NodB (nodulation protein B from Rhizobium) which is a chitooligosaccharide deacetylase. It also includes chitin deacetylase from yeast, and endoxylanases which hydrolyses glucosidic bonds in xylan..
Pfam Number: pfam01522 Score: 155 E_value: 2e-11
Swissprot: Q0JF21|AGI_ORYSJ

Sequence:
>Contig1665
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTTGTACAAA
TTGTCCCCCTGCCCTTTTCCTTATATCCTTCGCTTCATCCCTTTCATTCC
ATTAACTCCTCTCCTTTACATGCACTTGCTACAATGATTTCGCCCATTTC
TTCCATCGGCCTACTAGGGCTTAGCACTTACTTCGGCGCACTGGTCGGTT
CTACAGCAATTCCCCCAAATAATATTTTTTCTAGACAATCTACTACCCCC
GATGGTACTTGTGGTGTCCAAAACTCTGGCAATGGGAGAGGCTATAGATG
TACAACTGGCTCCTCAGCGTGTTGTTCTCAGTGGGGATGGTGTGGAGATG
GCTCAGAGTATTGTGGGAGTGGCTGTCAACCGAGTTACGGGGTATGTCCA
ACCCGAACTATGATACACTGATTCTTTCTACTCTTAACTAATATCCTGGA
TAGAGCTGTGGTAGTACTGGAGGAGGCAACCCTCCCGGAGGTGGAGGCAA
CCCTCCCACCACCGGGGGACGTACGAAGCCTGGCAGTGTCCCTTACGGGA
CTGTAATATCGAGTTGCACTGCTGGAGGTGTTGTTGCCCTGACATTTGAT
GATGGTCCCTACACCTATACCTCGAACCTATTGGACCTTCTTGCGCGGTA
CGGGGCTAAAGCAACATTCTTCGTCAACGGCCAAAATTGGGGAGCACCGA
TTACCGACCCTTCAAAGCAAGACTTGCT

Sequences in the Contig:

SY0AAA17YB06FM1 SY0AAA58YB24FM1