Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1664
Length(NT) : 484
Best Gene Model Blast : Link to GSTUMT00004944001 E-value : 1e-126
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_12114
Accession: ref|XP_001407475.1| Score: 194 E_value: 8e-14
KEGG Definition: hypothetical protein
Accession: mgr:MGG_12114 Score: 194 E_value: 4e-14
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3808 Score: 211 E_value: 3e-18
PFAM Definition: DUF1242, Protein of unknown function (DUF1242). This family consists of a number of eukaryotic proteins of around 72 residues in length. The function of this family is unknown..
Pfam Number: pfam06842 Score: 271 E_value: 4e-25
Swissprot: Q5BJC2|TM167_DANRE

Sequence:
>Contig1664
TTGGGTTCGACCTCTTACGTTTCTCAAGCTTAAGTTATCATATGATACCT
ACCTATTACCTGCCTCTACCTCGACGTAAACCCCCCGCTCTTCACGCTAC
CAGTACTTACTATCCCGTTCCCACATTAGTATTGTCATAGCTACGATGTC
CGCCCTTTTCCACTTTGATGCCCTGCTCCTGGTCATTCTCCTATTAATCT
GTACATGCACATACGTCCGCCAGACAGTCCCGGGAATGGTTGATTCGAGG
AAGGATAAGAACATCTTCTTCGGCATGTTCTGGAAGTTTGCGCGTATCGG
GGAGCGATTGTCGCCGTATGTTAGTATTTGCTGTATTATCATGGCTGTTG
TCACTTTCGTTTCTTGAGAGTGATGGGGGAACCATTTTTTTTTTTTGGCG
GTTTGATTCACCGGGGGAAGGTACGGCTGGAATTACAGTATGGTAGTAAA
TAATTATGGTTGAGGATTGCGAGATGGGAAAGTG

Sequences in the Contig:

SY0AAA58YB23FM1 SY0AAB57YL12FM1