Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1663
Length(NT) : 1100
Best Gene Model Blast : Link to GSTUMT00002283001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SNOG_08725
Accession: ref|XP_001799035.1| Score: 539 E_value: 4e-53
KEGG Definition: hypothetical protein
Accession: ang:An18g02330 Score: 523 E_value: 2e-51
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 128 E_value: 5e-08
Swissprot: P28349|NIT4_NEUCR

Sequence:
>Contig1663
TTGGTGTACTTTACTGTACTAGTACTTCTCCCGGCGTTGTACGATACGGT
ATTTTTCTCCTTGCTTCCTCGCTGCTTAGGTCTCGATCACGCCTTCTACC
GGCATCAGACCTTGACTCTTACGGTAGCTACAGGGTGCTGCAGACATCCC
ATACTGCCATTTCATGCCCCTGAAGGGCCTTGCTACTTCATCGGGTGGTT
TAGACTTGCGGAAGCCCATCAGAAGGAGCCTTTTTACACCCCTCCCCCGC
CCAGTAACCAGCTGACCCGAGATAGCGACACACTCGAGGGGAAAAAGGCC
CCGGGAACGCAGCTCCGGAGAAAGTCTCCTTCCCATCCTACAATCCTCCT
GTGAACCCGGTCTCCAAACCAACCGCACAAAACATGGCAGGCGTTACCTT
TGGACCAGCCGATACCAGAAATAGCAGCCGTCCCTCTTCCCCTGGCGTCG
GCGCGAGTGCGAATGGTCCAAGTAGTGGTGGTGGTGGTGGTCCTGGACGA
AGAGATAAACTGGGGGAATCCTCGAGGCCTCTGAAAAGACGCTGTGTCAG
TAATGCATGCATCGCTTGTCGGCGTCGCAAGTCAAAGTGTGATGGGAATA
CACCAGCTTGTGCGGCATGCGCGTCCGTCTACCACACCGAATGTGTCTAC
GATCCCAACTCGGATCATCGGCGAAAGGGGGTGTATAAGCAGGACATTGA
CAATCTGAAGACTCAAAATACCACATTGCACACTTTGGTCGAGGCGATTC
TGAATTACCCCGAGGATAAGGTGTTTGATTTGGTCAAGCAAATTCGAACG
TGTGACTCGCTTGAGGATCTTGTTGAGGGGATAATCGCGGAGCAGAATGC
AAATGCAGACCCGGACGAGGCATCGCCGGATGGCACGGCGGCGAATGGGC
ACCAACGAGACGCGGAGACCGGTGGAGATCGGCCCATCAGTCTGGAGGCG
GAACTCAGCGGGAAGATGGGTCGACTAAGGGTTGAGGATGGTCAAGTGAG
ATTTATTGGAGCAACGTCGAATCTGTTGTTCGTGACGCCAACATCATATT
CAACGGAAGAGGACGAACAGAGTGAGATTGAAGGGAGAAACAAATCCGCG

Sequences in the Contig:

SY0AAA15YN20FM1 SY0AAA26YH09FM1 SY0AAA27YF02FM1
SY0AAA55YG18FM1 SY0AAA58YB03FM1 SY0AAA62YD22FM1
SY0AAB4YG21FM1 SY0AAB54YF22FM1