Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1662
Length(NT) : 1082
Best Gene Model Blast : Link to GSTUMT00009236001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 119 E_value: 5e-07
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 109 E_value: 7e-06

Sequence:
>Contig1662
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTTCGGTTGTGTGTGTTT
GTTGGGGAAGTTTTGGTTTTTCTATATATATCTCATTTGTGGCCACTTTT
CTTTGGATGCGAGACGACTGTGTTGCCAACGATACCATACCATACGGTAC
GATTACTATAGAGGGAGTAGGCGCGAGGTTCGGAGAAGGAGAGAGAGAGG
GAGAGAAAAGAAGGGGAACGGATAAGAGGAGGAGCATCTAGAAATCGACA
GCCATGGCATTGCGATACCTAACCATGTTTTCCGCCCTTCTAGCCACGGT
TCTGGCAAAGGACGCCAACGACCCAAGCCCTCTAAAAAACGCGAATCTCC
TGCTAACGCCGGGTCTCCTTCCCGCGAGGCCTCTGCTCGGGCGGAGCCAC
AACCCATTCGAACCATTACTCTCCGCAGTGACCGGGCGACTTCTTAGACA
CGTTGATCCCGAGAAGCGTGTCTGCGGGGGATCGGCCCTCCACTCGGCGT
GTCCGAATGATGTGACGAAATGTTGCCCAACTGGCGGGGATTGCTGCGGT
GATGGGATATGCTGCGAGTATGGACATATGTGTCAGAAAAATCACCTGGG
GGGGACAGTTTGTTGTCCGAAGGGTCGTGATTGTTCTTTGATGCTGCCGA
TTAATCCGTGTGCGATTGCGACACATACCAAGTGTGCGGGTTTCGATGCG
TGCTGTCCGCCGAATAATACCTGTCAGCTCGTTGGCGATAGTATATCTTG
TATTGGCCTGCCTAGGGGCGGTGGCAGGAATGTACTTGCAAAACGTCAAG
TAAGCACTTCCGGTATGGTTTCTGGCGGCCCGGGATCAGGGCCGACGTCT
ATTCCTCCAGTGACTTCAGTTCCCCAGCCCCCTAGCAGCTCCCCTACCCG
ACCACCTTCCACAAGCATCCCCGCTCAGGTGCCTTCCTCAAGTACCGTTC
GGCCGCCTTCCTCAAACCCCCCCTCCATCATTACCCAACCGCCCACTACC
ACTACCCTGCCACCTCCAATCACCACTCGGTCGCCTTCAACCACCACTCG
CCCACCCGCAGCCACCACTCGGCCACTCTCAA

Sequences in the Contig:

SY0AAA39YL14FM1 SY0AAA3YA07FM1 SY0AAA40YA10FM1
SY0AAA44YK01FM1 SY0AAA58YA14FM1 SY0AAB33YN18FM1
SY0AAB44YI11FM1