Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1661
Length(NT) : 2920
Best Gene Model Blast : Link to GSTUMT00008714001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: SRF-type transcription factor RlmA
Accession: ref|XP_001263588.1| Score: 742 E_value: 4e-76
KEGG Definition: hypothetical protein; K09265 MADS-box transcription factor, other eukaryote
Accession: ani:AN2984.2 Score: 631 E_value: 2e-63
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0014 Score: 242 E_value: 9e-21
PFAM Definition: SRF-TF, SRF-type transcription factor (DNA-binding and dimerisation domain)..
Pfam Number: pfam00319 Score: 196 E_value: 2e-15
Swissprot: P38128|SMP1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0008301 = Molecular function: DNA bending activity
GO:0003700 = Molecular function: transcription factor activity
GO:0045944 = Biological process: positive regulation of transcription from RNA polymerase II promoter
GO:0047484 = Biological process: regulation of response to osmotic stress

Sequence:
>Contig1661
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCCGCACAACTTTGTAC
AAGAAAGCACACACATACCCTTCTCTCTTTTACCCTTCAACATTTCCCTC
CAGGTCAACCATTTCCCCCCAACAGCAGAGCCCTCGTTGTGTATCCTACC
TATTCCTCTTACATAACTATCCCCGTTGCCTCCCTACCTAACCCATTCAT
CCATTCATCTGGCAACCTATATCTTTTCGCCTCATCCACATCCTTTCCCT
CCGTTGTCCCCTACCTCGTCCTCCATAGCCAACACCGCCGTTGCCTCCGC
CACTGCCGCGTTCGCACATTATTTTTGATTCAATCCACGTCGCTCTTGGA
GTCTTCACCCTGATTGATTGATCAACTTTGCACCGTTGCGTTGTTGCACT
GATACCTCCAGTTACCTGAACACCCACTCTCCCGGAATACGAAACTTTCT
GCATCTCGGAATAGTTTCTTCACCAACACTCTATCCTATCACCCCCGGCA
TCCCTACAAGATGGGGCGAAGAAAGATTGAAATCAAAGCGATTAAAGACG
ATCGAAACCGATCAGTAACCTTCTTAAAGCGTAAAGGTGGTCTGTTCAAG
AAGGCTCATGAGCTTTCCGTGCTCTGCTCGGTAGATGTTGCTGTCATAAT
ATTCGGTCACAACAAAAAATTGTACGAATTCTGCTCGGGCGATATTCGGG
AGGTCATCGGACGACACAGTTACTATGAGGCTCCCCATGAACACAAAGGT
CCGGCCGATTTTCAGGGAAAGAAGGATGCTATGGATGATGACGATGACGA
TATGGATATTCCTTCTCGACCTGGCTCCCGGTCTTCTAACGACCATCCCA
TGCCTCACCCTCTCCAGTCGTTAGGGCATATGGGAAACCGTCATTCGACA
TCTGCATCACCTCCGATCCCTCCATCCACCTTGATGGGGGGGCAAGGAAC
CTATATGCAAGGTCGTGTCGGGACCCCACAGCCGATGTCCAGGCCTTCTT
CCCGCAACCAGCGACGGAATAGTTCGAATATGGTGCCTCCATCTACTTAC
GCTTCTTCGCAAGGCCCTCCAGCGCAGAATGGCTTTCCTTACATGCCCAG
TGGGCCCGTCTTTACGCCTCAGCCGCAACCCGTGATGCCTATGCAGCAGG
GGAACATGAATCAGATGCCCGTGTATCCTTACCCTCAAACGACGCAAGCC
CAGGCTCAGGCTCAAGCCCAAGCCCAAGCATACATCAATGAGACGAATAG
GAGACAATCAATGCCACCTACCTTCCCTTCTGAACGCCCTGTTCCATCGT
CTGAGAACTCACCTCCAAATAGGCCGCTCGATGAGCAAGTTGCGCCGGCG
ATTGAAAAACGCGCTCCCGCCAAATCACGAAGTATGTTCACACCTATCGG
ACCCAGTGAGTCCTTATTGGCGCAGCATTTCGGATTTGGTCAAGAGCCCT
CGCGGTCTCATTCGGTAGATGTTGGCTCCGTGGCTCGGTCAAGTAGTACA
AGCGGCATGAACAACGTTTCGGTAAAGTCAGAGAAGCAGTCTCCTAAGCC
TGCTCCCGCTTCCGTACCTGCGCCGACAACATCCAGTAACGCGAATGGCC
AACAACCATCCGTGGAACCTGTCCCGCCTCCACCATCCCGAACCAACAGC
ATGGCATCGAATCCAGGGAAACCTGGTGTACGACCAAGGCTCAAAGTGCA
AATACCTAGCGAGCACTCTGATGCTGGCGACGCCACTGCCGAGTCTTCGC
CACGAGAATCTGCGGGCACTACAACTGGTCAATCGGTCAAGGGTGTTGGT
GAAGGCAACCACCCGGTTGTACTTCCGCCACCTTCGCCCAGTGTCACGCT
TCGGAGCGCAGGTGCCAGTGGTGGACCAGTCAATCCATTCGCACGACCAC
CTCCAGCTACAACTGGCGCGCCATCAGAAACTCCCATCTCTGCTCTACCA
AGTCGATTCTGCGATAACGGATTGTTACCTTCACCCTCCACATTCTATCA
GGATTGGGGCATCGGTTTTGGAACATCAGCATCTCGTGCGGGCGGTAACT
CGGATATGCTTCCCAGCCCGTTGAATTTCCAGACACCCGTAGTGTCAACA
GGTCGGAATATTTTTGGAGAGGACTCGGATGTGAATGGCAAGAGGAAGAG
CCCGGGATCGGACAATTCGGATGGCTCAGCACCGAAACGAGTCAAGACAT
GAGATTGGGCGGAGAGGCAGAGCTCAAAGACTTGCCCTGCTGGGGTTCAG
GGTGATATCAGATTCCATTGTGGATAGTTTAGTTTAATATTCGACCCCTA
CTTTCTTTGCTTCACACCCCGCCTTCGCCCTCTTCGGGAGACGTTGTCGC
GGAGCAGAATGTGGATTATGTTATGTTTTCTACGTTGGGTGGAGATCGGC
GTTTAACCGTTTCGGAGTCCAAAAGGGAACGAGAAAAAGAAAATTGACAT
AAATTTTTATTTTATTTGGGGTTTCTATTTCGGATCTCGTTTTGCAATCT
CATTACCTTCTTTTTTGTATTTTCACTTTCTTCTGGGCCGGGATTCTGCC
TTTCGTTTCTTGCATCCTCTTTTCGCTTTTTCCTTCCCTCACCCAATTTT
TTCCGTCCAAGATAAGAGGGACCTTTTCACTTTCTCACATGGCATTATCT
TAGGGTCTTCCATGAGCATTTTTTCCCCCTTCGTTTGGCTTTCTTCTACT
CCATTTTCGTTTTCTATCCGCCCTTTTTTTTACTCACTTTGACACTTTAT
GTTTGCGTGATGCATGCATGCATTGGCATTCATCTGTTTTTTATTTCATT
TTCCCCTTTCTCCTTTCTTTTTTGCACGGGTTGGCTGATTTTCTTCTCCT
TGTTCCTTCTTTATACTATTTTGGTTGATGGATGGATGGATGGGTTGATC
AAGCTTTCCCAATCTTTCTC

Sequences in the Contig:

SY0AAA1YC07FM1 SY0AAA58YA12FM1 SY0AAA58YC10FM1
SY0AAB25YF17FM1 SY0AAC18YP16FM1 SY0AAC19YC10FM1
SY0AAC24YA08FM1 SY0AAC25YA08FM1 SY0AAC25YM03FM1
SY0AAC57YB03FM1 SY0AAD11YC06FM1 SY0AAD45YE02FM1
SY0AAD47YM17FM1