Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1660
Length(NT) : 2218
Best Gene Model Blast : Link to GSTUMT00003597001 E-value : 0.0
Numbers of ESTs : 40

Blast Results:

Nr Definition: hypothetical protein SNOG_14447
Accession: ref|XP_001804633.1| Score: 1092 E_value: 1e-117
KEGG Definition: hypothetical protein; K07300 Ca2+:H+ antiporter
Accession: ani:AN0471.2 Score: 1043 E_value: 1e-111
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1397 Score: 1219 E_value: 1e-134
PFAM Definition: Na_Ca_ex, Sodium/calcium exchanger protein. This is a family of sodium/calcium exchanger integral membrane proteins. This family covers the integral membrane regions of the proteins. Sodium/calcium exchangers regulate intracellular Ca2+ concentrations in many cells; cardiac myocytes, epithelial cells, neurons retinal rod photoreceptors and smooth muscle cells. Ca2+ is moved into or out of the cytosol depending on Na+ concentration. In humans and rats there are 3 isoforms; NCX1 NCX2 and NCX3..
Pfam Number: pfam01699 Score: 293 E_value: 8e-27
Swissprot: Q99385|VCX1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0015085 = Molecular function: calcium ion transmembrane transporter activity
GO:0006816 = Biological process: calcium ion transport
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>Contig1660
TTGGCATATTTGGACCCACTACTCGATGATCCCACTTGCAGTTGTCGCGC
CCATTTTTACTACTGTATCTTCAACCTTATTTCTTTGTTCTCGGATACCC
GCACCCTTACTTTCCGAACAGCGAGCGTAAAAGATTCAAACTGAAGGATA
TTCGGCTAACAAAGACCGGCCTGGTGCCGTATCGGCGCCATCGCTGGAAC
CTTTGGACAGGGTTATTAAAAAGACGCTTCTCTTTAATTGCACGCGGTAT
TCGGGAGCGGATGCCTCCATTTGGAGATATTGAAGAAGGCCGTCCTTCTA
GACAAAACTCAGAGCGAGGTCCTCTCCTAGATGGACCGAATGGAAATGGC
TATGCCGCTGGCTATGGTGATGCAAATGGCCGTATAGCGCCACGGAGCCA
GGGGCCTAGGAGGGGCGGGTTTGGTTCGCATGTATGCTCCAAAACGAAGG
CCATTCTGCTCAGCAACTACGTGAACACCCTTCTCATCTTCGTGCCCCTC
GGCATCGTGGCGGGCGCCATGAAATGGAACTCAACTGCGATTTTCGTCAT
GAACTTCTTGGCCATTATTCCTCTCGCGGCCTTGCTGAGCTTTGCTACTG
AGGAGCTAGCCCTCATGGTGGGGGAAACTCTGGGCGGGCTGTTGAATGCG
ACATTTGGAAATGCGGTAGAATTGATTGTTAGTATTGTCGCACTTACAAA
GGGGGAAATCAGAATTGTGCAGGCCAGCATGTTGGGTAGCATTTTATCCA
ATATCCTTTTGGTCTTGGGAATGTGTTTCTTTTTCGGGGGTCTCAAGCAC
AAGGAACAGAATTTTAACACCACTGTTGCGTCCACCATGTCATCACTTAT
GGCGGTCGCATCATCGTCCTTGATCATTCCTGCAGCGCTCTATTCGACGC
TCGCTGCGCCCAAGGAGGCATCATTTAAACTTATCCTTGACTTGTCCCGT
GGCACCTCTGTGGTCCTGTTGATCCTCTACGTTCTTTACCTAGTTTTCCA
ACTCGACACTCACGCCTATCTCTTCGACGCTCAGCACGAATCCGGCGAGA
GCGACGACGACGAGCCGCAGGGGCAGCAGACGGCGCTGCTATCGGGCGTT
GAATCAGGAGTCGTTTTGGTGGTGGTGACTGTTATGGTAGCGGTTTGTGC
GGAATACTTGGTTGGCTCTATAGACGAGATAGTTGCCAGCTCAGGCATCA
GCAAGACTTTTATTGGGCTGATTCTCATTCCAATCGTGGGCAATGCTGCC
GAGCACGTTACAGCAGTCGTGGTGGCTATGAAAAACAAGATGGATCTAGC
CATTGGCGTTGCTATCGGCAGCAGCATGCAAATCGCCTTGCTGGTCACCC
CGTTTTTAGTCATCCTTGGGTGGATTATCGGGCAGCCCATGAGCCTGTAC
TTCCAGACTTTTGAGACAGTAGTGTTCTTTGTGAGCGTGCTCATAACAAA
CTATCTCATCCAAGACGGTAAAAGCAATTACCTAGAGGGGGCTATGCTAT
TAGGGATATATACCATCATCGCCATCAGCTTCTTCGTATACCCGGATTCA
GCCGGTTCACTGGGCGGCGTGCCCGGACAGTCATGATTTCGAGAGAGAGA
AAAAACCCTGCGATACTCTTACTCCTACCTACTTGCAACAAATTTTTTTA
AAAAAGGGCAGAAGGTCGTTATCCACCCCGCCCTGTCATGACGGCAAGGT
CTGAAATAAAAGGAAAAAGAACACTGGAAACTTGACAAAAAAAAGTGAAA
AAATAAAAGAAATACGACTTCATCCGCCTAACCAGCTGAAGAGGTGGAGC
TTGCGAAAACAAGAAACAACAATATTATTATTCATTTCTTCCCCTTCCTC
TAAAGTCGGTTGAATAATTGGAACACAAGCGGTCCGCCCATCCACTTGGC
TCTGTCTGGCGGAAGATGTCCTTAAAGAGCAATTACTGTTTATACATACT
ATGCCTAGTCGTTTATTTATTCCCTTGCGTTCTTGCATATCTCCCCTGTC
GCCCTCCCCTCAACTCCACATCAAATGTTTGAAAAAGCCCCTTTGTTCCT
TTATTCACTTCTTGTAAACTGTATTAACAATTCTCTTTCTCTTTCCTTTC
CTTTTTTTGGAATTTTTTTTTTTTTGGAATTTTTTGTTTCCCTGGGATCG
TTTGTGCGGAGTTGGTCAGTTTAGTTTTTATAATCTAGTCTGCGAGTAGT
TGTTTAATATGATACGCA

Sequences in the Contig:

SY0AAA10YJ18FM1 SY0AAA13YB14FM1 SY0AAA18YM05FM1
SY0AAA20YD01FM1 SY0AAA20YD01RM1 SY0AAA21YF01FM1
SY0AAA23YE23FM1 SY0AAA23YE23RM1 SY0AAA31YA12FM1
SY0AAA32YI21RM1 SY0AAA32YP07FM1 SY0AAA34YP13FM1
SY0AAA37YH07FM1 SY0AAA39YB07FM1 SY0AAA39YP16FM1
SY0AAA42YL04FM1 SY0AAA44YE17FM1 SY0AAA50YG14FM1
SY0AAA50YL05FM1 SY0AAA50YP02FM1 SY0AAA52YD14FM1
SY0AAA56YF24FM1 SY0AAA58YA04FM1 SY0AAA5YM04FM1
SY0AAA61YD22FM1 SY0AAA63YG07FM1 SY0AAB17YB11FM1
SY0AAB1YD23FM1 SY0AAB1YO16FM1 SY0AAB21YL04FM1
SY0AAB53YB06FM1 SY0AAB53YE23FM1 SY0AAB6YN02FM1
SY0AAC17YO01FM1 SY0AAC21YD20FM1 SY0AAC21YD20RM1
SY0AAC30YI01FM1 SY0AAC49YM02FM1 SY0AAD56YL04FM1
SY0AAD7YJ11FM1