Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig166
Length(NT) : 901
Best Gene Model Blast : Link to GSTUMT00008345001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: splicing factor u2af large subunit
Accession: ref|XP_001261475.1| Score: 880 E_value: 9e-93
KEGG Definition: splicing factor u2af large subunit
Accession: afm:AFUA_7G05310 Score: 878 E_value: 8e-93
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0120 Score: 599 E_value: 8e-63
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 127 E_value: 4e-08
Swissprot: P26369|U2AF2_MOUSE

Sequence:
>Contig166
TTGGCTTTCGGGAAGTAAAATCTTAGGTCTTCTTGAATTCAAAAACACCA
ATGATGCCACAGTTTGTTTGGCACTCTCTGGAATTGAATTTAACGGGGGT
AATATTGAGATCAAGCGGCCAAGGGATTATATCGTTCCTATTGTACCTGA
AGACCACCGCCACCAAGAACCTGGAGTAATATCAAGTGACGTTCCTGACA
CGCCTAACAAGATATTGATTTCGGAAATACCCGAATATTTGCAGGATGAA
CAGGTTATCGAGTTATTGAAGAGTTTCGGGGATTTGAAGGCATTCGTTCT
CGTCAAAGATGTGACTGACGAGACATCTAAGGGAATCGCCTTTTGTGAAT
ACCTTGATCCTGGAACCACGGAAATAGCCGTGGAAGGCCTTAACGCTATG
GAAATTGCCGACAATACCCTCCGAGTACGACGTGCTTCCATTGGCATGAA
ACAAGCAGCTGGTGTCGAAATGGGCGTCAACGCAATGGCCATGATGGCTG
GCACAACAAGTGTGGATCTTGAAGCCAGCCGTGTATTGCAATTGCTTAAT
ATGGTGACCGCTGATGAGTTGCTCGATCCCGAAGAATATGATGAAATATG
CGAAGATATCCGTGATGAATGTCAAAAATTTGGATCGCTTGTTGACATGA
AGGTTCCCCGTCCTAGCGGGGGCAGCAGACAAGCAGCCGGTGTCGGCAAG
ATCTTTGTTCGCTTCGAAACTCAGGAATCTGCGTCTAACGCTCTACGTTC
CCTCGCTGGAAGAAAGTTCGCTGATAGAACTGTTGTCTGTACTTACTTCT
CAGAGGAAAATTACGAAGTCGGAGCCTTTTAGGATCCCCTTTCCCTCGTA
ATGCTATTTCTGACACCATAACTTACCCTAGCTCTAAAATGTAGCTCCGT
A

Sequences in the Contig:

SY0AAA16YA22FM1 SY0AAA29YL12FM1 SY0AAB40YB02FM1
SY0AAB58YL09FM1