Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1659
Length(NT) : 893
Best Gene Model Blast : Link to GSTUMT00006666001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: DUF1014 domain protein
Accession: ref|XP_752907.1| Score: 241 E_value: 1e-18
KEGG Definition: DUF1014 domain protein
Accession: afm:AFUA_1G15390 Score: 241 E_value: 6e-19
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3223 Score: 322 E_value: 1e-30
PFAM Definition: DUF1014, Protein of unknown function (DUF1014). This family consists of several hypothetical eukaryotic proteins of unknown function..
Pfam Number: pfam06244 Score: 321 E_value: 1e-30

Sequence:
>Contig1659
TTGGTGAGTGCATACAAAGAACTGCCCACAATCCCAATCACCACATCTAC
CAAGTCCTAAAACCACGAAGCAGCCATAGCCAATCCGATAGAGAGCCAAA
TGCCTAAAAAGCAAGTCGAGAATTCAAAAAAGGCTGCCGGAAATGCGAAG
AAGGCTGCCGCGGCTGCTACCAAAGCCGATGCCGAAAATTCACGAAGGGC
AGCCGAGGAGGCACAAGAGTGGGAGAAGGGTGCTAAGAGTAATGCCAAAA
AAGAGGCAGCCGAGGCCAAGAAGCGTGATGCGGCCGCTAAGAAGGCCGCT
GCGGCTGCAGCACTAGCAGAGGAGGAGCGCGCACTTCCTTCAAAACCCAA
GCCCGCCAGAGCCGGCCCAGCTAAGCGGACTAAAGGGATCGACTCTGCGT
TGGGATCTCTGAACGCTAGCAATGTCGACGACGCCCTTGATGCTTTGACT
TTAGCTACTGGGGCTGAGAAAGGCACCATTGATCGGCATCCCGAAAGGCG
CTACAAAGCTGCATACGCAGCGTACGAAGAGCGCAGATTACCGGAGTTTC
GTGAGGAGCATAAGGGGCTTAGGCTTGGGCAGATGAAGGAATTGATCAAG
AAGGAGTTTGAGAAGAGTGAGGAGAACCCATTCAACCAGGTTGGCAACGT
GCGCTACGATGCTACTAAGGATGAGATTGCACTTGCGAAGAAGGCTGAGA
TGGAAAAAATCGAGGTCAGGCTTGGTGGGAAGTAGCTGTGTTTTTCTTCT
CTTGGTCATTTTTCCGGCGTTTGATCGCGATGGGTGGGAGGTGGACTTCA
TTGTGGTTGCGATGGGATACCTGAGCTTGTGTTTTACCATGGGTATCCAT
ATCTTGTCAAACTCTCTGACCCTAACTTGACTGAAGCTTTGGC

Sequences in the Contig:

SY0AAA16YH06FM1 SY0AAA29YE13FM1 SY0AAA57YP22FM1
SY0AAB14YB10FM1 SY0AAB36YG10FM1 SY0AAB4YE04FM1
SY0AAB55YN08FM1 SY0AAB61YA01FM1 SY0AAC62YN09FM1
SY0AAD32YA15FM1