Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1658
Length(NT) : 808
Best Gene Model Blast : Link to GSTUMT00000394001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: pyridoxine
Accession: ref|XP_755192.1| Score: 639 E_value: 7e-65
KEGG Definition: pyridoxine [EC:2.6.-.-]; K08681 glutamine amidotransferase
Accession: afm:AFUA_2G08580 Score: 639 E_value: 3e-65
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3210 Score: 385 E_value: 4e-38
PFAM Definition: SNO, SNO glutamine amidotransferase family. This family and its amidotransferase domain was first described in. It is predicted that members of this family are involved in the pyridoxine biosynthetic pathway, based on the proximity and co-regulation of the corresponding genes and physical interaction between the members of pfam01174 and pfam01680..
Pfam Number: pfam01174 Score: 381 E_value: 1e-37
Swissprot: Q8LAD0|PDX2_ARATH
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004359 = Molecular function: glutaminase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0042819 = Biological process: vitamin B6 biosynthetic process

Sequence:
>Contig1658
TTGGAGCGACTCAAACAAACATCCCATCTACAGGCAGCGCATTAAAAAAA
TGTCAGGCAATGATAGCATCACCGTCGGAGTTCTTGCTCTCCAAGGAGCC
TTTTCTGAACACTTAGAGTTGTTGAAGAAAGCTGCGGAACAAATAGAAAC
TCCCAAGAAGATTGGGTTTATCTCAGTCAAGACTCCAGTCGATTTGGAGA
AATGCTCGGCTCTAATTATTCCTGGTGGAGAGAGCACTACAATGGCTTTG
ATTGCTGAACGCAGTAACATCCTCGAGCCTCTCAGAGAGTTTGTTAAAGT
TCACCGTCGTCCCACTTGGGGTACATGTGCCGGCATGATCCTTCTCAGCG
AAGCCGCAAACCGTACCAAGAAAGGCGGGCAAGCTCTTATCGGGGGCCTC
TCTGTTCGCGTGAACCGCAATCACTTCGGTCGTCAAGTAGAATCCTTCGA
TGCTCCTTTGGATCTCAGTTTTCTTGGGAATGATGAAGCACCATTCCGAG
GCGTATTCATCCGAGCGCCAATTGTTGAATCGATCCTTCCAAAAGAAGAG
TGGTCGGAAGATGTCGAAGTTCGCGCACCATCAAAGAAACCCAAGGGAGC
GATCGAGGAGTGCTTTAGTGATAACGAGAATGTGGAGATACTTTGCCAAC
TCCAGAGGAGGTTGCTACCTGCCGAAGGACTCGGTGCTACCGATGGACTC
CGACACGAGTCCGATCCCAAAGGGGAAGTCGGTAAAATTTGTGTGGGTCT
TAAGGAGAGCTGCACTAATGCTAGTAGCATTGTTGCTGTTCGTCAGGGAA
ATGTCGTT

Sequences in the Contig:

SY0AAA2YB08FM1 SY0AAA57YO03FM1 SY0AAC13YA06FM1
SY0AAC48YH18FM1