Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1657
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00008952001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001241133.1| Score: 490 E_value: 8e-48
KEGG Definition: short chain dehydrogenase, putative [EC:1.-.-.-]; K00540
Accession: afm:AFUA_4G08710 Score: 474 E_value: 3e-46
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 182 E_value: 1e-14
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 204 E_value: 4e-17
Swissprot: P39640|BACC_BACSU

Sequence:
>Contig1657
TTGGCAAAAGAGCGATCATTATGAACTCCAGCTTCCGTATCAGTTCAGGT
TTGGCTCGCCGTCTACTCCAACAATGTGGGGTATCGGCTCCGAGAAGGTT
ACTCCCATTCGGGGCCTCACTTGTCACTAGACATATATCATCTTCGCCGG
ATACGAACGTGACACCGGGGCTGACTCCCAAAGCTACTGGGAAAGCATTT
GAAGGCAATGGCAAGGTTTTGCTCGGGTCCCAAAAGCGTCTTCCGGAGTT
CAATCTAGTCGATAGAGTAGTGCTTATCTCTGGTGGAGCACGAGGTCTTG
GACTAACGCAAGCTGAAGCTCTGCTTGAAGCTGGAGCCAAGGTTTATGCC
CTCGACCGCCTTGAGAAACCATCGCCGGGGTTCTACGAAGCCCAAGCCAG
AGCTACCAATAACCTTGGGACTTCCCTACACTACAGACAAATAGATGTGC
GGGATGAAGCAAAACTGCACGCATCTGTCCAGGCCATCGCCGAAGAGAAT
GGCCGACTAGATGGCTTGATAGCAGCAGCAGGCATCAACGAAGAGCACAC
AGCTCTGGAATACACGGCGGCAGATTTCAACAAAATGATGGAGATCAACG
TTACGGGTGCCTTCCTGACTGCGCAAGCAGCAGCTAGGCAAATGGT

Sequences in the Contig:

SY0AAA57YI12FM1 SY0AAA57YN24FM1 SY0AAB35YI04FM1